Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the...
Order the steps in RT-PCR:
1. Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately.
2. Degrade the RNA strand with base, leaving just the cDNA.
3. cDNA is produced, which is single-stranded and complementary to the RNA of interest.
4. Double-stranded DNA for the region of interest is produced.
5. Add two primers (one forward and one reverse) located within the sequence of the RNA of interest. Also add DNA polymerase, dNTPs, and a buffer with Mg2+. Cycle temperatures appropriately.
6. Obtain an RNA sample.
Homework Answers
Answer: 6-1-3-2-5-4
1) Obtain an RNA sample.
2) Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately.
3) cDNA is produced, which is single-stranded and complementary to the RNA of interest.
4) Degrade the RNA strand with base, leaving just the cDNA.
5) Add two primers (one forward and one reverse) located within the sequence of the RNA of interest. Also add DNA polymerase, dNTPs, and a buffer with Mg2+. Cycle temperatures appropriately.
6) Double-stranded DNA for the region of interest is produced.
Follow the Figure for details:
Add Answer to:
Order the steps in RT-PCR:
1. Add one primer complementary to the 3' end of the...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Please help with all questions. I provided all the information that I have. The sequence below...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Most questions answered within 3 hours.
-
In the Chesapeake region during the mid-17th
century how similar was the experience of an independent...
asked 2 hours ago -
. A 2.50 M stock solution was used to prepare a dilute NaOH
solution with a...
asked 2 hours ago -
Write a program that reads in a text file, infile.txt, and
prints out all the lines...
asked 5 hours ago -
Which of the following orbits have a total of zero energy (based
on the common convention)?...
asked 5 hours ago -
Find the expected count and the contribution to the chi-square
statistic for the (Group 1, No)...
asked 6 hours ago -
Suppose you are purchasing a meal and with every meal a you
receive one of 10...
asked 6 hours ago -
A 75.0 kg 0erson is riding in a car moving at 20.0 m/s when the
car...
asked 6 hours ago -
What does Δp = QR mean in words?
Pushing a viscous fluid through a pipe requires...
asked 6 hours ago -
We know that system.out.println (“object number” + n ); is
legal.String name; int n; name =...
asked 6 hours ago -
Come up with a real-life problem (open-ended) and solve it by
designing and writing a Java...
asked 6 hours ago -
Power Music owns five music stores, where it sells music,
instruments, and supplies. In addition, it...
asked 7 hours ago -
True or false and
why:
Given the following sequence of numbers to be
inserted {4,5,6,1,2,3,8,7}, the...
asked 7 hours ago