Question

2. Read each question carefully. Write your response in the space provided for each part of each question. Answers must be written out in paragraph form. Outlines, bulleted lists, or diagrams alone are not acceptable and will not be scored. Researchers studying the phylogenetic relationships among African elephants (Loxodonta africana). Asian elephants (Elephas maximus), and woolly mammoths (Mammuthus primigenius) analyzed cytochrome b DNA sequences from several organisms of each species. Cytochrome b is a mitochondrial protein that functions in the electron transport chain. Partial sequences of cytochrome b mitochondrial DNA are often used in phylogenetic analyses. DNA was obtained from mammoth bone fragments radiocarbon dated to between 12,000 and 14,000 years ago and from living African and Asian elephants. Table 1 shows a partial cytochrome b DNA sequence for the reference individual (an African elephant) and some of the sample individuals studied. Dugongs (Dugong dugon) were identified as the outgroup in this study. Dugongs are marine mammals that are relatives of the larger group of elephant-like animals, the proboscideans. Table 1. DNA sequence data for three species showing only the sequence differences Reference Loxodonta AAAAAATCCTTCTTTACACTCCA Loxodonta-1 . G CG ..... ... ......G Loxodonta-2 .G.CG......T...G.....T. Elephas-1 • GGC......CT.CCC. GTCT. Elephas-2 .GGC......CTCCCC. GTCT. Mammuthus-1 CG.C.G.T...T.C.CT.T.... Mammuthus-2 CG.C.G.T...T.C.CT.T.... hus-1 (a) Based on the data in Table 1, identify the animal that has the greatest number of sequence differences from the reference animal.

Answer 1

a. From table 1, it is evident that Elephas 2 contains greatest number of sequence dissimilarity with the reference animal. Out of ttal 23 nucleotide, Elephas -2 showed difference at 13 positions.

d. Though organisms differ in their morphology, they may have close evolutionary relationship. Morphological similarity may be due to exploitation of similar environment, similar food habit and similar prey predator relationship. It may happen that two animals which have distant evolutionary relationship, may have similar morphology due to the reason that they both exploit similar ecological niche. On the other hand, it is evident that two morphologically dissimilar organisms are actually evolutionary close. Their morphological dissimilarity is due to exploitation of drastically different ecological niche.

b. The cladogram is shown below

Lonodonta Mammuthus Elephas Dugongs