1.Describe and compare eukaryotic and prokaryotic flagella.
2.Describe post-translational and cotranslational transport.
3.Describe prokaryotic mRNA translation in detail, including all steps from start to finish, including all factors.
4.Describe the molecular events involved in regulation of the lac operon in response to both glucose and lactose levels, and transcript (mRNA) abundance regulation in the prokaryotic trp operon including attenuation.
5.Completely describe transcript (mRNA) abundance regulation in the prokaryotic trp operon, and discuss whether or not the attenuation mechanism of transcriptional regulation is appropriate for eukaryotes.
Ans 1. Flagella serve similar functions in eukaryotic and prokaryotic organisms. But the structures are completely different in these two.
Flagella in eukaryotic organisms are microtubule based structures which are anchored at the cell membrane by basal bodies or centrioles.
There are single stranded in prokaryotic cells and 11 stranded in eukaryotic cells.
The size is smaller and are narrower in prokaryotic cells whereas they are larger and thicker in eukaryotic cells.
It is composed of protein flagella in prokaryotes and protein tubulin in eukaryotes.
They perform lashing or undulatory movements in eukaryotes and rotatory movements in prokaryotes.
1.Describe and compare eukaryotic and prokaryotic flagella. 2.Describe post-translational and cotranslational transport. 3.Describe prokaryotic mRNA translation...
1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the correct start codon and what proteins are involved in the process? please include the shine-dalgarno sequence in the answer. 2. Consider the following partial sequence of messenger RNA. The sequence below contains the code for a short, complete protein. 5 ́-UCCCCAGUCAUGGAGUCGUUAAUUAAAUGACCGGUGCGGAUCGUA - 3 ́ Using the codon chart (from your textbook or in the lecture slides), give the amino acid sequence of the protein...
biochemistry Question 2 [10] Tabulate the main differences between prokaryotic and eukaryotic replication. Question 3 [10] Describe the basic principle governing Meselson and Stahl's experiment. What would the results of Meselson and Stahl have looked like if DNA replication were conservative? And what would it have looked like if DNA replication were dispersive? [8] Question 4 Describe in detail the structure of tRNA and its function in translation Question 5 [20] 5.1 List the two types of transcription termination mechanisms...
1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’ B) 5’ACUCUCUUCCUGCUCACAAU3’ C) 5’UAACACUCGUCCUUCUCUCA3’ D) 5’UGAGAGAAGGACGAGUGUUA3’ 2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind? 3.The lac operon is ON in which situation: A) Low glucose low lactose B) Low glucose high lactose C) High glucose high lactose D) High glucose low lactose 4.You have isolated an E. coli mutant that has a deletion of the gene encoding the...
Choose two (2) of the mechanisms of gene expression regulation in eukaryotic cells denoted by rows shown (7 possible in the Figure below. I will only grade your first to for completeness and will NOT grade any more that you write. If you do an EXTRAODINARY job on your answers, you may ear bonus points For each of your choices answer the following 4 questions using COMPLETE sentences 1. What are the base structural differences between molecules (pink, blue or...