Question

1. What transcript is produced from this gene?

5’ ATTGTGAGCAGGAAGAGAGT 3’

3’ TAACACTCGTCCTTCTCTCA 5’

A) 5’AUUGUGAGCAGGAAGAGAGU3’

B) 5’ACUCUCUUCCUGCUCACAAU3’

C) 5’UAACACUCGUCCUUCUCUCA3’

D) 5’UGAGAGAAGGACGAGUGUUA3’

2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind?

3.The lac operon is ON in which situation:

A) Low glucose low lactose

B) Low glucose high lactose

C) High glucose high lactose

D) High glucose low lactose

4.You have isolated an E. coli mutant that has a deletion of the gene encoding the cAMP receptor protein CRP. Under which conditions would lacZ, lacY and lacA be expressed in this mutant strain?

A) Low glucose low lactose

B) Low glucose high lactose

C) High glucose high lactose

D) High glucose low lactose

E) None of the above

5.Select the DNA sequence closest to the trp leader region that encodes an enzyme involved in tryptophan biosynthesis

A) trp p B) trp o C) trp C D) trp E E) trp A

trp leader region (not drawn to scale) Number of base pairs in indicated region 162 1560 1593 1350 1196 804 300 DNA trpD trpc

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. A) 5’AUUGUGAGCAGGAAGAGAGU3’

2.ANTICODON     3' UAC 5'
mRNA               5' AUG 3'

3. B) Low glucose high lactose
Lac operon is ON when there is no glucose present in the media and lactose converts into allolactose and enter into cell and activates the LAc operon.

4. E) None of the above
Without CRP, cAMP not bind to the CAP region so RNA polymerase not able to bind Promoter region.

5. D) trp E

Add a comment
Know the answer?
Add Answer to:
1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • Which The figure represents the trp (A-C) and the lac (D-G) operons. A and D show...

    Which The figure represents the trp (A-C) and the lac (D-G) operons. A and D show the operons without any proteins bound to them. The others have one or more proteins bound to them. Use the figures your notes to answer the next four questions. OK? = este lace laco acz | lacy = D = trpP tro trpe trpo trpetrpctra EA lacp Lac Rep- pressor lacz lacy RNAP holo enzyme trpo tro trpe trpe treo trpD trpB trpe trc...

  • Six E. colimutants were isolated. The activity of the enzyme beta-galactosidase produced by the cells was...

    Six E. colimutants were isolated. The activity of the enzyme beta-galactosidase produced by the cells was measured when the cells were grown in medium supplemented with different carbon sources. Put your answer into the right-hand column of the table. Glycerol Lactose Lactose + Glucose Mutation in Wild-type 0 1000 10 -------- Mutant 1 0 10 10 Mutant 2 1000 1000 10 Mutant 3 0 0 0 Mutant 4 0 1000 10 Mutant 5 1000 1000 10 Mutant 6 0 0...

  • You have systematically mutagenized the lac operon in E. coli to produce a mutation that disrupts...

    You have systematically mutagenized the lac operon in E. coli to produce a mutation that disrupts the function of each of the following elements: a. the promoter for LacI (P(I)) 
 b. the LacI gene 
 c. CRP binding site d. the promoter for the lac operon (P(lac)) 
 e. the operator sequence f. a mutation in lacZ that disrupts the coding region but does not disrupt transcription 
 g. a mutation in lacZ that blocks transcription 

 For each of the above mutations, what...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • Background: Several genetic regions are needed for lactose metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene), lacY(permease gene), lacA(transacetylase...

    Background: Several genetic regions are needed for lactose metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene), lacY(permease gene), lacA(transacetylase gene) and lacI(repressor gene). Strains can be defined as having + - c or s copies: + refers to the functional version, - refers to a defect version, c refers to a constitutively active version and s refers to a superrepressor version. Each strain may or may not have an extra-chromosomal plasmid containing the genes indicated. TA=transacetylase it would be very helpful if you...

  • Please solve all of them Lac Mutants 1-Copy 2 of 10 CAP laclCAP gene lacO lacP...

    Please solve all of them Lac Mutants 1-Copy 2 of 10 CAP laclCAP gene lacO lacP acolacZacY Carbon source in theLac operon p-galactosidaseLactose permease binding site me levels in levels in the cell polycistronic mRNA enzy levels in the cell Undetectable Low but detectable Low but deteteable Low but detectable medium the cell Undetectable membrane Glucose only Glucose and lactose Lactose on Another carbon source Undetectable Undetectable Undetectable Undetectable The table shows the results of experiments measuring expression of the...

  • UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles...

    UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles of the lac operon, expression of lacZ and lacY is inducible, constitutively on or permanently repressed. (erepressor; r cannot bind operator: osoperator, o cannot bind repressor, lac are LOF mutations) A. lacZ is inducible, lacY is constitutively on. B. lacZ is constitutively on, lacY is inducible. C. lacZ is permanently repressed, lacY is constitutively on. D. lacZ is constitutively on, lacY is permanently repressed....

  • 3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of...

    3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of certain cell divisions during development. LIN-14 protein levels are normally high in early development but decrease in the later stages. In a lin-4 mutant, the level of LIN-14 protein stays high throughout development, changing the pattern of cell divisions in the animal and producing defects in the shape of the animal. The lin-4 gene encodes a microRNA that binds to a sequence in the...

  • Quiz 10 1. (2 points) Which of the following conditions would lead to the highest levels of lac operon expression? a) High lactose, high glucose b) High lactose, low glucose c) Low lactose, high...

    Quiz 10 1. (2 points) Which of the following conditions would lead to the highest levels of lac operon expression? a) High lactose, high glucose b) High lactose, low glucose c) Low lactose, high glucose d) Low lactose, low glucose e) None of the above would have any lac operon expression 2. (2 points) Which of the following is true concerning molecular genetics? a) tRNA carries amino acids into the nucleus in eukaryotic cells b) DNA polymerase moves towards the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT