Question

The figure represents the trp (A-C) and the lac (D-G) operons. A and D show the operons without any proteins bound to them. TA bacterial cell has a trp operon that looks like B and a lac operon that looks like E. It could be in medium o containing glWhich

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
Which The figure represents the trp (A-C) and the lac (D-G) operons. A and D show...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • 1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...

    1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’ B) 5’ACUCUCUUCCUGCUCACAAU3’ C) 5’UAACACUCGUCCUUCUCUCA3’ D) 5’UGAGAGAAGGACGAGUGUUA3’ 2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind? 3.The lac operon is ON in which situation: A) Low glucose low lactose B) Low glucose high lactose C) High glucose high lactose D) High glucose low lactose 4.You have isolated an E. coli mutant that has a deletion of the gene encoding the...

  • Please solve all of them Lac Mutants 1-Copy 2 of 10 CAP laclCAP gene lacO lacP...

    Please solve all of them Lac Mutants 1-Copy 2 of 10 CAP laclCAP gene lacO lacP acolacZacY Carbon source in theLac operon p-galactosidaseLactose permease binding site me levels in levels in the cell polycistronic mRNA enzy levels in the cell Undetectable Low but detectable Low but deteteable Low but detectable medium the cell Undetectable membrane Glucose only Glucose and lactose Lactose on Another carbon source Undetectable Undetectable Undetectable Undetectable The table shows the results of experiments measuring expression of the...

  • You are asked to develop a demonstration to show how the lac operon works. You decide...

    You are asked to develop a demonstration to show how the lac operon works. You decide to use X-gal and IPTG to determine if the enzyme ?-galactosidase is active. X-gal is a lactose analog that turns blue when metabolized by ?-galactosidase, but it does not induce the lac operon. IPTG is an inducer of the lac operon, but is not metabolized by ?-galactosidase. a. (2pts) Which of the following would you expect to bind to ?-galactosidase. Circle all that apply....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT