Draw structures for each of the following tripeptides.
Cys-Leu-Ser
What tripeptides would be produced from the partial hydrolysis of Ser-Leu-Gly-Gly-Ala? Enter the three-letter abbreviations of the tripeptides separated by commas. my answer - Ser-Leu-Gly-Gly,Leu-Gly-Gly-Ala This answer was wrong and says I need more products,, I think maybe 3 products , as opposed to the 2 I have, I don't know how to find the other products. Please help. Part A What tripeptides would be produced from the partial hydrolysis of Ser-Leu-Gly-Gly-Ala? Enter the three-letter abbreviations of the tripeptides separated...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
6. Translate the following amino acid sequence into one-letter code: Leu-Glu-Ala-Arg Asn-le-Asn-Gly-Ser-Cys-lle-Glu-Asn-Cys-Glu-le-Ser-Gly-Arg-Glu-Ala-Thr.
Deduce the sequence of a heptapeptide that contains the amino acids Met, Gln, Phe, Leu, Cys, Val, and Arg, from the following experimental data. Edman degradation cleaves Cys from the heptapeptide, and carboxypeptidase forms Gln and a hexapeptide. Treatment of the heptapeptide with chymotrypsin forms a hexapeptide and a single amino acid. Treatment of the heptapeptide with trypsin forms a pentapeptide and a dipeptide. Partial hydrolysis forms Gln, Cys, Phe, and the tripeptides Leu-Met-Val and Met-Val-Arg. Be sure to answer...
please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
(A) What are the correct DNA sequences that led to the following polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop (ii) Met-Ser-Leu-Asp-Ala-Trp-Stop (B) What are the correct polypeptide sequences that result from following DNA sequences? (i) tgaggcataacttactgacttgcccttacgactaagattcttt (ii) ggtaagtcctctagtacaaacacccccaatattgtgatata
A protein has the following N-terminal sequence and the following organization of signal/stop/start sequences. Met-Lys-Trp-Val-Thr-Phe-Leu-Leu-Leu-Leu-Phe-Ile-Ser-Gly-Ser-Ala-Phe-Ser-Arg-… i) What is the topology of this protein in the cell membrane? The red segments correspond to either signal sequences or stop transfer sequences. The orange segments correspond to start transfer sequences ii) What is the N-terminal sequence of the protein, after processing iii) Is this a eukaryotic or prokaryotic protein? Why? Signal Stop Start Stop Start
A decapeptide that is part of an insulin-like peptide has the molecular formula: Asn, Arg(2), Ser(3), Phe, Cys, Leu, Thr. After partial hydrolysis, the fragments are: Cys-Ser-Phe-Ser- Arg-Asn-Ser-Cys Thr-Leu-Arg Ser-Thr What is the sequence? Ser-Phe-Ser-Thr-Leu-Arg-Arg-Asn-Ser-Cys Arg-Asn-Ser-Cys-Ser-Phe-Ser-Thr-Leu-Arg Ser-Thr-Arg-Asn-Ser-Cys-Ser-Phe-Ser- Asn Thr-Leu-Arg-Asn-Ser-Cys-Ser-Phe-Ser-Phe A compound shows an IR peak at 1740 cm". Its proton NMR spectrum consists of 1.07 ppm, t, 3H, 2.25 ppm, quintet, 2H, 2.36 ppm, m, 4H, 3.61 ppm, s, 3H and 4.01 ppm, 4, 2H. The most likely structure is
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop