(A) What are the correct DNA sequences that led to the following polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop...
(A) What are the correct DNA sequences that led to the following polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop (ii) Met-Ser-Leu-Asp-Ala-Trp-Stop (B) What are the correct polypeptide sequences that result from following DNA sequences? (i) tgaggcataacttactgacttgcccttacgactaagattcttt (ii) ggtaagtcctctagtacaaacacccccaatattgtgatata
Homework Answers
i- ATG- CAT/C- CCG/A/C/T- CTG/C/T/A - TGC/T - TAT/C-UAG/A
CAT/C means there could be two codons - CAT and CAC
ii - ATG - TCT/C/A/G - CTG/C/T/A - AAT/C - GCT/A/G/C - TGG- UAG/A
III - Since first codon is the stop codon so given sequence will not be translated
Stop codon Gly Ile Thr Tyr Stop codon Leu Ala Leu Thr Thr Lys Ile Leu
IV- Gly Lys Ser Ser Ser Thr Asn Thr Pro Asn Ile Val Ile
Please write to me if you need more help.
Add Answer to:
(A) What are the correct DNA sequences that led to the following
polypeptide sequences? (i) Met-His-Pro-Leu-Cys-Tyr-Stop...
Which sequence is more soluble on water. a. Glu-Lys-Leu-Met-His b. Lys-Ser-Ser-Tyr-Glu c. Asp-Phe-Trp-Met-His d. His-Tyr-Ser-Ala-Glu e....
Which sequence is more soluble on water.
a. Glu-Lys-Leu-Met-His b. Lys-Ser-Ser-Tyr-Glu c. Asp-Phe-Trp-Met-His d. His-Tyr-Ser-Ala-Glu e. His-Ala-Cys-Gly-Glu o
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide...
please explain each question thoroughly. thanks
Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
clon 25 3 p Given the following DNA template, the sequence of the protein made is:...
clon 25 3 p Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG-----(+1)-------(-10)-------- --(-35 Leu-Ala-Cys-Met-Lys-Arg-lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg.lle-Arg Ala Ser-Ser Asp-Ser-Leu-His-Ala-Ser-Stop
Which sequence is more soluble on water.
a. Glu-Lys-Leu-Met-His b. Lys-Ser-Ser-Tyr-Glu c. Asp-Phe-Trp-Met-His d. His-Tyr-Ser-Ala-Glu e. His-Ala-Cys-Gly-Glu o
Which of these protein sequences is most likely to span a cell
membrane?
Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811
please explain each question thoroughly. thanks
Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?
clon 25 3 p Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG-----(+1)-------(-10)-------- --(-35 Leu-Ala-Cys-Met-Lys-Arg-lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg.lle-Arg Ala Ser-Ser Asp-Ser-Leu-His-Ala-Ser-Stop
Most questions answered within 3 hours.
-
This java code won't run and I can't figure out the problem with
it. Please help...
asked 36 minutes ago -
Trace the following recursive methods:
a) isPal with the string “abccda”
b) isAnBn with the string...
asked 1 hour ago -
1. Which of the following is false about photosynthesis?
A. ATP is the molecule used to...
asked 2 hours ago -
A simple random sample of size n=64 is obtained from a
population with a mean of...
asked 3 hours ago -
(2 dimensions, 1 object, 2 accelerations)
1) A projectile is thrown with a wind. The wind...
asked 4 hours ago -
Brian makes $34,100 per year. How much can Brian expect to
contribute to FICA taxes in...
asked 4 hours ago -
To buy a new house you must borrow $155,000. To do this you take
out a...
asked 5 hours ago -
Spacely Sprockets is evaluating the construction of a new plant
on land the company purchased for...
asked 6 hours ago -
1. Consider a linear regression model of y on K regressors and
an intercept.
(i) Describe...
asked 6 hours ago -
Enter a balanced equation for the reaction between hydrochloric
acid and sodium sulfite.
Express your answer...
asked 6 hours ago -
Give a regular expression describing the language
{x | x ∈ Σ* and x does not...
asked 6 hours ago -
Masses of 1.0 kg, 2.0 kg, and 3.0 kg are each separately subject
to a net...
asked 6 hours ago