10) The answer will be Met-Arg-Asn-Ser (Second option).
Explanation: Transcription & translation both occurs in 5' 3' direction. Template strand is given in 3' 5' direction. So, mRNA transcript will be 5' GUACAUGCGUAACUCUUGAGCG 3'. Now, initiation codon in translation is AUG, which encodes methionine (Met) (Indicated by blue arrow in the picture). After that we find CGU, which encodes arginine (Arg). Next, AAC will encode asparagine (Asn). Then UCU will encode serine (Ser). Next, we will encounter stop codon UGA which will terminate the transcription. As a result, polypeptide sequence will be Met-Arg-Asn-Ser. Thus, correct answer will be second option.
Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
Question 29 2 pts DNA coding strand DNA template strand - The sequence of the peptide that would result from transcribing and translating the gene pictured would be Met-Arg-Leu. Tyr-Ala-Asn. no peptide would be made, the first codon means "stop." lle-Ser-Val. Tyr-Ser-Val.
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...
On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro