What is the role of the protein
encoded by the lacZ gene?
Homework Answers
|
Ans: The lacZ gene encodes an enzyme that converts lactose to allolactose, and the lacZ gene encodes an enzyme that converts lactose to glucose and galactose. |
|
In lac operon, lacZ genes encodes for the enzyme B- galactosidase. This enzyme can:
|
Add Answer to:
What is the role of the protein
encoded by the lacZ gene?
What is the role...
3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of...
3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of certain cell divisions during development. LIN-14 protein levels are normally high in early development but decrease in the later stages. In a lin-4 mutant, the level of LIN-14 protein stays high throughout development, changing the pattern of cell divisions in the animal and producing defects in the shape of the animal. The lin-4 gene encodes a microRNA that binds to a sequence in the...
Match the protein listed below with the gene that encodes it or with the DNA sequence...
Match the protein listed below with the gene that encodes it or with the DNA sequence within the lac operon where it binds: lac repressor (encoded by...) [Choose] lac repressor (where it binds...) [Choose ] B-galactosidase [Choose] Lactose permease [Choose] Galactoside transacetylase [Choose] CAP [Choose] lacz lacy lacl Operator CAP site lacA
1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
Background: Several genetic regions are needed for lactose metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene), lacY(permease gene), lacA(transacetylase...
Background: Several genetic regions are needed for lactose
metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene),
lacY(permease gene), lacA(transacetylase gene) and lacI(repressor
gene). Strains can be defined as having + - c or s copies: + refers
to the functional version, - refers to a defect version, c refers
to a constitutively active version and s refers to a superrepressor
version. Each strain may or may not have an extra-chromosomal
plasmid containing the genes indicated. TA=transacetylase
it would be very helpful if you...
pls give short answers Q15 8 Points In C. elegans, a protein encoded by the gene...
pls give short answers
Q15 8 Points In C. elegans, a protein encoded by the gene odr-4 is required to transport the protein ODR-10 to the cell membrane of the worms' sensory neurons. As described in HW7, ODR-10 detects the molecule diacetyl, which is secreted by the worms' bacterial food source. What would happen to the animals' ability to detect diacetyl if there was a mutation in the odr-4 gene that inactivated it? (One sentence) Why (one sentence)? Enter your...
4. Nutritional status, mutation, and expression of the lac operon. For each of the following conditions,...
4. Nutritional status, mutation, and expression of the lac operon. For each of the following conditions, indicate how much (a lot, a little, or none) of the lacZ gene (z-gene) product, beta- galactosidase, is being synthesized. NUTRITIONAL STATUS OF THE BACTERIA +lactose/-glucose +lactose/+glucose -lactose/+glucose genetic status normal (no mutation) mutation a mutation b mutationc important: these are nor the same mutations as the ones in your class handout mutation a: a mutation in the start codon for the lacA (A-gene)...
Lactose (or rather, its derivative allolactose) can lift the Lac Repressor protein from the Operator site...
Lactose (or rather, its derivative allolactose) can lift the Lac Repressor protein from the Operator site in DNA, thus allowing for expression of the genes coded by the Lac Operon. However, lactose cannot cross the bacterial cell membrane without the help of the Permease protein channel, which is coded by the lacY gene in the Lac Operon. So, it appears that we have a case of "what's first, the chicken or the egg?" - how can lactose enter the cell...
An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant...
An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant mutation in gene A over accumulate substrate X, which causes severe neurological symptoms. At the molecular level, this enzyme functions as a homodimer. A homodimer is a protein composed of two subunits that are encoded by the same gene. Let’s suppose you are able to purify subunits from cell samples and then mix them together under conditions in which they form homodimers, and you...
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of...
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...
Illustrate a conjugation event with an F’ cell that is lacIS lacP+lacO+lacZ- lacY-on the bacterial chromosome...
Illustrate a conjugation event with an F’ cell that is lacIS lacP+lacO+lacZ- lacY-on the bacterial chromosome and lacI- lacP+ lacOC lacZ+ lacY+ on an F plasmid with an F-cell that is lacI+ lacP+ lacO+ lacZ+ lacY-. Draw both cells before the conjugation event, as well as the recipient cell after conjugation occurs. Underneath all three cells, note whether the production of permease and beta-galactosidase would be high, basal, or none, and describe HOW the proteins and DNA sequences interact to...
3. (2 points) In the nematode roundworm, Caenorhabditis elegans, the LIN-14 protein controls the timing of certain cell divisions during development. LIN-14 protein levels are normally high in early development but decrease in the later stages. In a lin-4 mutant, the level of LIN-14 protein stays high throughout development, changing the pattern of cell divisions in the animal and producing defects in the shape of the animal. The lin-4 gene encodes a microRNA that binds to a sequence in the...
Match the protein listed below with the gene that encodes it or with the DNA sequence within the lac operon where it binds: lac repressor (encoded by...) [Choose] lac repressor (where it binds...) [Choose ] B-galactosidase [Choose] Lactose permease [Choose] Galactoside transacetylase [Choose] CAP [Choose] lacz lacy lacl Operator CAP site lacA
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
Background: Several genetic regions are needed for lactose
metabolism: P(promoter), O(operator), lacZ(b-galactosidase gene),
lacY(permease gene), lacA(transacetylase gene) and lacI(repressor
gene). Strains can be defined as having + - c or s copies: + refers
to the functional version, - refers to a defect version, c refers
to a constitutively active version and s refers to a superrepressor
version. Each strain may or may not have an extra-chromosomal
plasmid containing the genes indicated. TA=transacetylase
it would be very helpful if you...
pls give short answers
Q15 8 Points In C. elegans, a protein encoded by the gene odr-4 is required to transport the protein ODR-10 to the cell membrane of the worms' sensory neurons. As described in HW7, ODR-10 detects the molecule diacetyl, which is secreted by the worms' bacterial food source. What would happen to the animals' ability to detect diacetyl if there was a mutation in the odr-4 gene that inactivated it? (One sentence) Why (one sentence)? Enter your...
4. Nutritional status, mutation, and expression of the lac operon. For each of the following conditions, indicate how much (a lot, a little, or none) of the lacZ gene (z-gene) product, beta- galactosidase, is being synthesized. NUTRITIONAL STATUS OF THE BACTERIA +lactose/-glucose +lactose/+glucose -lactose/+glucose genetic status normal (no mutation) mutation a mutation b mutationc important: these are nor the same mutations as the ones in your class handout mutation a: a mutation in the start codon for the lacA (A-gene)...
13. Protein B regulates ubiquitination of the protein encoded by gene A If the level of protein B changes, what else do we expect to change (please answer yes/no for each)? Transcription of gene A? Splicing of gene A? Rate of translation of RNA copies of gene A? Overall level of protein A in the cell? yes 14. Imagine that a protein regulates a gene. Given that it regulates the other gene at the following levels, circle all that will...
Most questions answered within 3 hours.
-
Minitab Problem: Take the Lake Hume June rainfall data and find
use the processes outlined in...
asked 44 minutes ago -
X Company is trying to decide whether to continue using old
equipment to make Product A...
asked 45 minutes ago -
IN PYTHON ONLY !! Program 2: Re-work
program #5 (WeeklyHours) from the previous assignment such that...
asked 1 hour ago -
The average length of time between arrivals at a turnpike
toll-booth is 26 seconds. What is...
asked 3 hours ago -
(a) A piston at 6.1 atm contains a gas that occupies a volume of
3.5 L....
asked 4 hours ago -
Please answer true or false. Words
cannot be changed or added in to make it true...
asked 4 hours ago -
An empty test tube weighs 15.923 grams. Then,
MgCl2•6H2O is added into the test tube. After...
asked 4 hours ago -
Assume memory access is 10 units of time and disk access is
10000 units of time....
asked 4 hours ago -
1. Are all good samples random?
2. Magazines often report surveys giving statistics such as “63%...
asked 4 hours ago -
Under all the various types of market structures, firms
must eventually earn some economic profits for...
asked 4 hours ago -
Consider the following fitness regime for a single locus trait
with two co-dominant alleles: w11 =...
asked 4 hours ago -
A large cable company reports the following.
80% of its customers subscribe to its cable TV...
asked 5 hours ago