1. CORRECT ANSWER is (A) [Please explain why this is the correct answer]
2. CORRECT ANSWER is (A) [Please show all work for the Reaction Mechansim]
Homework Answers
Add Answer to:
1. CORRECT ANSWER is (A)
[Please explain why this is the correct
answer]
2. CORRECT ANSWER...
Choose the correct answer and explain why you choose that answer. -Page 2 4. The Claisen...
Choose the correct answer and explain why you choose that
answer.
-Page 2 4. The Claisen condensation produces which of these? a- An α-keto ester b.AB-keto ester C, A β-hydroxy ester d. A B-hydroxyaldehyde e. A B-di ketone 5. Which compound could be prepared using a Michael reaction? 0 0 o 1 CCH3 СОС2HS a. I d. IV e. v Part 2 t. The product (s) of the reaction of 2 mol of ethyl butanoate sodium ethoxide is(are) : b....
the correct answer is E. please explain why and show all work What are the products...
the correct answer is E. please explain why and show all
work
What are the products of the following reaction acid HxO S O V O ' yo OCH 3 I + H20 o°CH 3 OCH 3 E none of the above
Please only do C. Explain why the answer is correct. If the answer is not correct...
Please only do C. Explain why the answer is correct. If the
answer is not correct explain the right way thank you.
Consider the following propositions over the integers N. • p:n is a divisor of 12 • q: n is even What are the truth sets of a)p b) p 1 a c) p +9 For finite sets you can list the elements, but for infinite sets (if there are any) use set builder notation. Be sure to show...
The images depict the answer key. Please explain why the answers are correct by drawing the...
The images depict the answer key. Please explain why the answers
are correct by drawing the mechanisms.
34. (3 pts) Which one of the structures below is not an intermediate in the multi-step mechanism of the following reaction? HOCH2CH2OH H + H2O H2SO4 OH HO QH2 A) B) -H D) H -H НО: OH OH 16. (3 pts) Which one of the structures below is not an intermediate in the mechanism of the following reaction? 1) LiAIHA НО. ОН 2)...
Please explain the alcohol that dehydrates the fastest and why. The structures are correct. 1. For...
Please explain the alcohol that dehydrates the fastest
and why. The structures are correct.
1. For the alcohols listed below: Write the major dehydration product. Which of the alcohols dehydrates with the fastest rate? Why a. b. он a) methul b) он он c) The alcohol that dehydrates at the fastest is (explain why):
Please answer all of the questions with an explanation on why the correct answer is right. These ...
Please answer all of the
questions with an explanation on why the correct answer is right.
These are Chemistry questions.
2. (4pts) Which of the following has the highest pll if they all have the same initial ntrations? A. NaCI B. HCI C. NaF D. H2SO E. CH3COOH i C (4pts) Using the Ka's on the front page, which of these base is the weakest? 3. A. F B. NH3 C. C2H302- D. CIO- E. NO2- 6. (4pts) Which is...
Could you explain why C is the correct answer 13. (3 pts) Of the following compounds,...
Could you explain why C is the
correct answer
13. (3 pts) Of the following compounds, which is the most acidic? A)
please explain why the correct answer and why the other choices are wrong. thank you very...
please explain why the correct answer and why the other
choices are wrong. thank you very much! i have to study this!
21. Which of the following structures correctly represents trans-3-heptene? a. HzC- 22. Which of the following is the most acidic hydrocarbon? CH3 H3C H- CH3 e. CH3 CH3 H3C Which of these bases can deprotonate acetylene (PK, 26)? The pK, values for the conjugate acids are shown in parentheses. a. NaOH (15.7). d. NaHCO3 (6.3) b. Butyllithium (50-60)...
can you guys please give me the correct answers and explain why? 25. The non-template strand...
can you guys please give me the correct answers and explain
why?
25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
Please answer all 3 questions QUESTION 23 Which of the following statements are true? 1. ethanol...
Please answer all 3 questions
QUESTION 23 Which of the following statements are true? 1. ethanol is more soluble in water than dimethyl ether 2. ethanol has a higher boiling point than dimethyl ether 3. ethanol has the same molecular weight as dimethyl ether only 1 only 1 and 2 only 1 and 3 1, 2 and 3 QUESTION 24 In a unimolecular elimination (E1) reaction, the correct order of mechanistic steps is dissociation of the leaving group, then deprotonation...
Choose the correct answer and explain why you choose that
answer.
-Page 2 4. The Claisen condensation produces which of these? a- An α-keto ester b.AB-keto ester C, A β-hydroxy ester d. A B-hydroxyaldehyde e. A B-di ketone 5. Which compound could be prepared using a Michael reaction? 0 0 o 1 CCH3 СОС2HS a. I d. IV e. v Part 2 t. The product (s) of the reaction of 2 mol of ethyl butanoate sodium ethoxide is(are) : b....
the correct answer is E. please explain why and show all
work
What are the products of the following reaction acid HxO S O V O ' yo OCH 3 I + H20 o°CH 3 OCH 3 E none of the above
Please only do C. Explain why the answer is correct. If the
answer is not correct explain the right way thank you.
Consider the following propositions over the integers N. • p:n is a divisor of 12 • q: n is even What are the truth sets of a)p b) p 1 a c) p +9 For finite sets you can list the elements, but for infinite sets (if there are any) use set builder notation. Be sure to show...
The images depict the answer key. Please explain why the answers
are correct by drawing the mechanisms.
34. (3 pts) Which one of the structures below is not an intermediate in the multi-step mechanism of the following reaction? HOCH2CH2OH H + H2O H2SO4 OH HO QH2 A) B) -H D) H -H НО: OH OH 16. (3 pts) Which one of the structures below is not an intermediate in the mechanism of the following reaction? 1) LiAIHA НО. ОН 2)...
Please explain the alcohol that dehydrates the fastest
and why. The structures are correct.
1. For the alcohols listed below: Write the major dehydration product. Which of the alcohols dehydrates with the fastest rate? Why a. b. он a) methul b) он он c) The alcohol that dehydrates at the fastest is (explain why):
Please answer all of the
questions with an explanation on why the correct answer is right.
These are Chemistry questions.
2. (4pts) Which of the following has the highest pll if they all have the same initial ntrations? A. NaCI B. HCI C. NaF D. H2SO E. CH3COOH i C (4pts) Using the Ka's on the front page, which of these base is the weakest? 3. A. F B. NH3 C. C2H302- D. CIO- E. NO2- 6. (4pts) Which is...
Could you explain why C is the
correct answer
13. (3 pts) Of the following compounds, which is the most acidic? A)
please explain why the correct answer and why the other
choices are wrong. thank you very much! i have to study this!
21. Which of the following structures correctly represents trans-3-heptene? a. HzC- 22. Which of the following is the most acidic hydrocarbon? CH3 H3C H- CH3 e. CH3 CH3 H3C Which of these bases can deprotonate acetylene (PK, 26)? The pK, values for the conjugate acids are shown in parentheses. a. NaOH (15.7). d. NaHCO3 (6.3) b. Butyllithium (50-60)...
can you guys please give me the correct answers and explain
why?
25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
Please answer all 3 questions
QUESTION 23 Which of the following statements are true? 1. ethanol is more soluble in water than dimethyl ether 2. ethanol has a higher boiling point than dimethyl ether 3. ethanol has the same molecular weight as dimethyl ether only 1 only 1 and 2 only 1 and 3 1, 2 and 3 QUESTION 24 In a unimolecular elimination (E1) reaction, the correct order of mechanistic steps is dissociation of the leaving group, then deprotonation...
Most questions answered within 3 hours.
-
For the reaction 1N2+3H2-----> 2NH3, would the reaction rate
trend be: delta[NH3]/ delta t = -2...
asked 14 minutes ago -
A sock stuck to the side of a clothes-dryer barrel has a
centripetal acceleration of 24...
asked 1 hour ago -
A perfect gas undergoes an isentropic process such that its
volume doubles. If the ratio of...
asked 1 hour ago -
list the elements in groups 3A to 6A in the same order as in the
periodic...
asked 1 hour ago -
Estimating effect size. Peng and Chen (2014)
evaluated effect size estimates for various tests. In their...
asked 1 hour ago -
Write a script in MySQL that creates and calls a stored
procedure name test. This procedure...
asked 1 hour ago -
If we test the following: H0: μ = 17
vs. H1: μ ≠ 17 and the...
asked 1 hour ago -
in the past year TVG had revenues of 3 million, cost
of goods sold of $25...
asked 1 hour ago -
4) In a polypeptide, which bond cannot rotate because of its
partial double bond character?
The...
asked 2 hours ago -
Assume that in the short run L = 1,000 and K = 100. 1. What is...
asked 2 hours ago -
At a given temperature, 2.06 atm of H2 and 3.7 atm of Br2 are
mixed and...
asked 2 hours ago -
Sodium reacts with Hydrochloric acid to form sodium chloride and
hydrogen gas. 2Na(s)+ 2 HCl(aq)-> 2...
asked 2 hours ago