Question

25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA synthetase for each tRNA. B. Aminoacyl-tRNA synthetases bind GTP and only release an aminoacyl-tRNA from the enzyme when the GTP is hydrolyzed to GDP. C. Aminoacyl-tRNA synthetases contain a catalytic RNA molecule. D. Aminoacyl-tRNA synthetases escort aminoacyl-tRNAs to the A site of the ribosome. E. An aminocyl - AMP is an intermediate in the reaction catalyzed by aminoacyl- tRNA synthetases.

can you guys please give me the correct answers and explain why?

Answer 1

Ans 25) Resulting RNA would have the sequence AAUUGAUGCGUA. So, option D is correct.

Explanation:

Non template strand is identical in sequence with the resulting RNA and so is also called sense strand whereas template strand is complementary to the resulting RNA and so is also called antisense strand.

In the question, non template strand is given as

   +1 I TATAATAGACAGAATTGATGCGTA

Here A is the start site of transcription.So, resulting RNA will form from this site and the sequence will start from "A".The sequence of RNA will be identical to the non template strand sequence from the start site onwards and "U"(uracil) will be present in place of "T"(thymine).

   Non template strand: TATAATAGACAGAATTGATGCGTA mRNA : AAUUGAUGCGUA

So, option D is correct.