30. Answer: Statement E is incorrect.
Explanation: RNA polymerase doesn't show any exonuclease activity.
The rest of the statements are correct.
31. Answer: Statement A is correct.
Explanation: Mediator interacts with auxiliary factors such as HMGA 1, SAGA, etc and helps to form the pre-initiation complex as well as recruit RNA Pol II. Thus helps to regulate gene expression.
The other statements are incorrect.
32. Answer: C
Explanation: In alternative splicing, in healthy cells, the exons are not scrambled like the case in "isoform C". They usually joined in the correct sequence. i.e. "exon A" before "exon B", "exon C" before "exon D" etc.. lIke it happened in all the other given spliced isoforms.
But in "C isoform" the exons are scrambled. i.e. "exon D" appeared before "exon B".
This type of scenario usually occurs rarely in neoplastic cells or in circular RNAs (where 3' and 5' ends are joined) but not in the general mechanism of alternative splicing.
can you guys please give me the correct answers and explain why? 30. Which of the...
can you guys please give me the correct answers and explain why? 12. Which of the following statements concerning histones is INCORRECT? A. The N-terminal tails of histone proteins are frequently post-translationally modified B. Histones are small, basic proteins. C. Histones bind DNA via hydrogen bonding with bases in the major groove. D. Histone HI is not one of the core histones. E. Histones are present in eukaryotes but not bacteria. V 13. You are studying two E coli genes...
can you guys please give me the correct answers and explain why? 9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...
can you guys please give me the correct answers and explain why? 3. Which of the following statements is CORRECT? A. Exposure of E.coli to UV light greatly increases the frequency of cytosine deamination B. Mutagens that intercalate into the double helix lead to the formation of thymine dimers. C) Oxidative damage to DNA usually leads to the formation of frameshift mutations. D. Some alkylating agents are mutagenic because they chemically modify amino acids in the active site of DNA...
can you guys please give me the correct answers and explain why? 27. Which of the following statements regarding tRNAs is INCORRECT? A. In the folded structure of a tRNA, the anticodon loop is located near the 3' end of the molecule. B. Highly conserved nucleotides de primarily in the "loops" rather than the "stems". C. All tRNAs have the same 3 base sequence at their 3 end. D. All tRNAs contain post-transcriptionally modified nucleotides. E. In most cells, tRNA...
QUESTION 1 Which of the following statements regarding splicing is FALSE? A) The length of introns determines the efficiency of splicing. B) Many human neurological disorders are caused by splicing errors and/or mutations in splicing factors. C) Splicing requires the action of a variety of snRNAs that direct the transesterification reactions. D) Splicing is dictated by sequence features in pre-mRNA transcripts QUESTION 2 Which of the following mRNA processing factors does NOT associate with...
can you guys please give me the correct answers and explain why? 19. You clone your favorite E. coli gene including the promoter region, the open reading frame, and some flanking DNA. You determine the DNA sequence of the entire region and map the start site of transcription. You note the following sequence near the end o your gene. What is the likely function of this sequence? ...CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTTTGAAGGTATAT... A. A polyadenylation signal B. A Rut site C. The ribosome binding...
can you guys please give me the correct answers and explain why? 25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
the answers i circled are incorrect. can you give me the correct answers and explain why? postural de Pero ss and so Lalash, an walach asymmetric carbon as Ror S. (3) label the How many asymmetric carbon atoms are present in the following compound A) B) 1 D) 3 E) 4 2) Which of the statements below correctly describes an achiral molecule? The molecule has a nonsuperimposable mirror image. B) The molecule exhibits optical activity when it interacts with plane-polarized...
can someone explain how to answer this with reasons why 30-45 mins after estrogen addition: Acchyiase (HAT, odde auhye 60-90 mins after estrogen addition: Reauitment ef Poy to open 7. T identify the Gene X DNA element responsible for regulation by a Growth Fagor, you perform a linker scanning experiment in which you mutate 10 bp Tegions centered around positions -205 to-5 in the Gene X promoter/promoter- proximal region (wt wild-type promoter). The promoter variants were tested for their ability...
Here is all the information and content! One of the questions which shows a double stranded sequence and asks for the mRNA sequence has not correct answer. It should be dropped. Anyone who majored in Bio can answer these 2nd-year biology multiple questions (only Q14 has more than one answer). Thanks a lot!!!!! Question This type of RNA does not participate in the splicing reaction, but is important for efficient functioning of the spliceosome. Not yet answered Marked out of...