12. Incorrect: C. Histones bind DNA via hydrogen bonding with bases in the major groove. (Histone actually interacts with DNA via ionic interaction between positively charged bases in histone and negatively charged phosphate backbone in DNA. Option A is correct and N terminal tail of histones are most often modified. The rest of the options are corecor.)
13. Answer: C. The gene B transcript is terminated by Rho. (If this happens then gene B will be transcribed less than gene A. Option A is wrong as all genes are transcribed 5' to 3'. Option B is wrong as the given information doesn't really imply it. Option D is wrong as both their 10-35 sequence has to be closer to consensus in order to have constitutive expression. Option E is wrong as all gene's ORFs start with an AUG codon.)
14. Correct: A. Contacts primase and stimulates its activity (clamp loader loads DNA polymerase, helicase travels on both strands, moves in 5' to 3' direction, helicase and topoisomerase are different enzymes)
15. Incorrect: D. The 2' hydroxyl makes it especially stable at high pH. (RNA is not at all stable in high pH and degrades very easily in basic conditions. The other statements are all correct.)
can you guys please give me the correct answers and explain why? 12. Which of the...
can you guys please give me the correct answers and explain why? 27. Which of the following statements regarding tRNAs is INCORRECT? A. In the folded structure of a tRNA, the anticodon loop is located near the 3' end of the molecule. B. Highly conserved nucleotides de primarily in the "loops" rather than the "stems". C. All tRNAs have the same 3 base sequence at their 3 end. D. All tRNAs contain post-transcriptionally modified nucleotides. E. In most cells, tRNA...
can you guys please give me the correct answers and explain why? 9. Which of the following statements is INCORRECT? A. Most human cells contain high levels of telomerase. B. Telomeres protect the ends of eukaryotic chromosomes. C. Telomerase is ribonucleoprotein D. Each round of replication shortens eukaryotic chromosomes. E. Telomerase is an RNA-dependent DNA polymerase. 10. DNA in front of the replication fork is positively supercoiled (over-wound). What is the source of energy required for this over-winding? Pollll Core...
can you guys please give me the correct answers and explain why? 3. Which of the following statements is CORRECT? A. Exposure of E.coli to UV light greatly increases the frequency of cytosine deamination B. Mutagens that intercalate into the double helix lead to the formation of thymine dimers. C) Oxidative damage to DNA usually leads to the formation of frameshift mutations. D. Some alkylating agents are mutagenic because they chemically modify amino acids in the active site of DNA...
can you guys please give me the correct answers and explain why? 30. Which of the following statements reg wing statements regarding the Alpha subunit of RNA polymerase is INCORRECT? A. Can bind an UP element B. Can interact with positive activator proteins C. Binds to the Beta and Beta' subunits D. Has distinct N-terminal and C-terminal domains E. Has 3' to 5' exonuclease activity 31. Which of the following statements regarding the mediator complex is arding the mediator complex...
can you guys please give me the correct answers and explain why? 25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...
For the four reasons listed below, please explain a solution for each reason. Thank you in advance! QUESTION 8 In the production of iPSCs, proteins that regulate transcription are injected into differentiated cells to revert them back to stem cells However, the efficiency of de-differentiation ie: returning to a stem cell like state is typically less than 1%. Give 4 reasons why in ecting the transcription factor proteins into the cell may not be enough to lead to change the...
can you guys please give me the correct answers and explain why? 19. You clone your favorite E. coli gene including the promoter region, the open reading frame, and some flanking DNA. You determine the DNA sequence of the entire region and map the start site of transcription. You note the following sequence near the end o your gene. What is the likely function of this sequence? ...CCCAGCCCGCCTAATGAGCGGGCTTTTTTTTTTGAAGGTATAT... A. A polyadenylation signal B. A Rut site C. The ribosome binding...
Please give me a complete solutions, don't work on it if you're not going to finished this. This is an old homework, in which I am using to study for the exam. So please don't give me half ass answers. QUESTION 11 If a DNA segment has the sequence GCTAA, what RNA sequence will be made from it? a. CGATT b. CGUTT c. CGAUU d. GCTAA e. UGATT 1 points QUESTION 12 Which of the following brings amino acids...
Can someone help me with this ASAP please! just the correct answer please. 39 There are othe DNA double helix is observed in the do when it is sure to single stands 39 29 The ONA ATGCGTTA is transcribed into an RNA strand with the sequence TACGCAAT B) UAACGCAU AUGOGLAL DI UACGCAAU S k ibstrat depression by ting the production of serta ng postati forecasing serotonin into the synapse prestati o n fees taking up scroton from the synapse e...
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...