27. A. the anitcodon loop is not located near the 3' end. its actually located at the opposite end of it.
28. A. cytosine forms a base pair with cytosine. cytosine can form 3 hydrogen bonds with guanine.
29. A. ACA is the sequence of the anticodon. each base has a specific partner Guanine always with Cytosine and Adenine always with Uracil
can you guys please give me the correct answers and explain why? 27. Which of the...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...
10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance! (Q21-25) We have the following double-stranded DNA sequences, which codes for a 10 amino acid long protein gene. Use the codon table and answer the questions. 5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3' 3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5' 21. Which strand codes for this protein? A. top B. bottom C. both strands D. none of the above 22. If this is a eukaryotic gene, which RNA polymerase will make mRNA? A. RNA Pol I...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...