Sequence #1: 5’AAATACATACTTGACATAGTAGCTTTCCAATATGGGAACATATGTTGTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATG-3’ Sequence #2: 5’TCGGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACTATAATCCTGATTTATGCACTACTATTAGTACTCACGGCGCAAT
Sequence #1:
5’AAATACATACTTGACATAGTAGCTTTCCAATATGGGAACATATGTTGTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATG-3’
Sequence #2:
5’TCGGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACTATAATCCTGATTTATGCACTACTATTAGTACTCACGGCGCAATACCACCA3’
Sequence #3:
5’CCAACACAACGCTATCGGGTCATATTTGACATTATAAGATTCCGCAATTATAATGGGACTACATGTAGGTTGCCTTAACGATATCCGCAACTTGCGATGTGCCTGCTATGCTT3’
Which sequence encodes a functional promoter? Please explain your answer in ≤ 2 sentences and/or show your work
Homework Answers
Add Answer to:
Sequence #1:
5’AAATACATACTTGACATAGTAGCTTTCCAATATGGGAACATATGTTGTACATCGGGCCGGGATAATCATGTCGTCACGGAACTTACTGTAAGAGTAATAATTCAAAAGAGATG-3’
Sequence #2:
5’TCGGTTTGCTAGTTCACGTAAAGGTGCCTCGCGCCACCTCTAAGTAAGTGAGCCGTCGAGACTATAATCCTGATTTATGCACTACTATTAGTACTCACGGCGCAAT
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed) #2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
1.) Please explain the importance of the Ficsher Esterfication reaction. 1-3 sentences will be sufficient. 2....
1.) Please explain the importance of the Ficsher Esterfication reaction. 1-3 sentences will be sufficient. 2. Which one in more soluble in water, propanoic acid or 1,3-propanedioic acid? Please explain why? 1-2 sentences will be sufficient. 3.) Name all of the functional groups that can undergo hydrolysis, and give the corresponding products. Also, include any conditions per reaction.
2. Consider the following sequence x(n) = cos (2n/3)sin(2ton/5). a. Is the sequence periodic? If yes,...
2. Consider the following sequence x(n) = cos (2n/3)sin(2ton/5). a. Is the sequence periodic? If yes, what is the period? If no, why not? Note: you need to show your work analytically but you can verify that your answer is correct by sketching the sequence using Matlab b. Find and sketch the complex exponential Fourier series coefficients (Magnitude and Phase). Verify using Matlab. Include code and graphics.
5. Here is another promoter region in E. coli. (Also in a larger format in the...
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
1.) Please explain the importance of the Ficsher Esterfication reaction. 1-3 sentences will be sufficient. 2....
1.) Please explain the importance of the Ficsher Esterfication reaction. 1-3 sentences will be sufficient. 2. Which one in more soluble in water, propanoic acid or 1,3-propanedioic acid? Please explain why? 1-2 sentences will be sufficient. 1.) Name all of the functional groups that can undergo hydrolysis, and give the corresponding products. Also, include any conditions per reaction. 2. What do carboxylic acids and carboxylic esters have in common in regards to reduction?
The Fibonacci sequence is the sequence of numbers: 0, 1, 1, 2, 3, 5, 8, 13,...
The Fibonacci sequence is the sequence of numbers: 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, … The next number is found by adding up the two numbers before it. For example, the 2 is found by adding the two numbers before it (1+1). The 3 is found by adding the two numbers before it (1+2). The 5 is found by adding the two numbers before it (2+3), and so on! Each number in the sequence is called...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
2. Consider the following sequence x(n) = cos (2n/3)sin(2ton/5). a. Is the sequence periodic? If yes, what is the period? If no, why not? Note: you need to show your work analytically but you can verify that your answer is correct by sketching the sequence using Matlab b. Find and sketch the complex exponential Fourier series coefficients (Magnitude and Phase). Verify using Matlab. Include code and graphics.
5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...
Most questions answered within 3 hours.
-
Write a Python program that stores the data for each
player on the team, and it...
asked 8 minutes ago -
In
the last 3 months, mike never knows when he is going to get his
allowance...
asked 32 minutes ago -
Is Ca(OH)2 a Bronsted base, Lewis base, or both? Why?
asked 22 minutes ago -
1A- Why don’t voters complain about U.S. tariffs on imported
sugar?
Because sugar is only a...
asked 31 minutes ago -
Cash Payback Period
Primera Banco is evaluating two capital investment proposals for
a drive-up ATM kiosk,...
asked 29 minutes ago -
Create a button in Swift (Xcode) that will create a charge,
create a charge using Stripe's...
asked 29 minutes ago -
The reaction rate of CO and NO2 in the reaction
CO(g) + NO2(g) → CO2(g) +...
asked 30 minutes ago -
Imagine that a chemist puts 6.40 mol each of
C3H8 and O2 in a 1.00-L container...
asked 48 minutes ago -
How much money should be invested today in order to have $8340
at the end of...
asked 51 minutes ago -
You are conducting research for a hospital and issue a survey to
patients.
Based on the...
asked 52 minutes ago -
What might be a negative mutation that would hinder the
bug population?
asked 1 hour ago -
A company just paid a dividend of $1.50 per share. The consensus
forecast of financial analysts...
asked 57 minutes ago