Determine the band gap values for the materials shown below, and
specify which are transparent to red light. Use any internet source
and include the source as part of your answer.
Si GaAs GaP CdS InAs SiC GaN ZnS CdTe
Determine the band gap values for the materials shown below, and specify which are transparent to...
Theory section is below for the equations
PRELAB Read the theory section below. Calculate the photon wavelength in nm corresponding to a photon energy equal to the theoretical band gap energy of S1.121 eV and GaAs, 1.422 eV. These will be used to set the monochromator. THEORY One of the most important characteristics of a semiconductor is its band gap energy Eg Whereas an electron in an isolated atom has discrete energy levels, an electron in a semiconductor crystal has...
Determine the complex transfer function T(s) = V/V; for the circuit shown below. Specify it as a function of the complex frequency, s, and the symbols for the resistors and capacitor. On the attached graph, plot the magnitude of the complex transfer function T(jw) in decibels as a function of the frequency f of the source as f varies from 1 Hz to 1 MHz. Assume that the op amp is ideal. Use as the numerical values for the resistors...
Project Requirements: 1. Based on the schematic approach indicated below, determine capacitances Cl and C2 and an ideal OP AMP configuration that will result in a band pass circuit having a maximum gain of 12 dB with -3dB frequencies at 10 Hz and 2000 Hz The OP AMP circuit should not produce any phase shift. In the OP AMP circuit don't use any discrete resistor values less than K2. In this design, Ti(s) is to be the transfer function of...
Problem 4: Read Appendix 2 below (Sec. 1.4.1 of Kasap) and then solve. A metallic back contact is applied to the CdTe solar cell of Problem 1 using a set up similar to that described in Figure 1.74 (b) on the next page. To form the metallic back contact, two evaporation sources are used, Cu and Au. An initial 3 nm layer of Cu is deposited first and then 30 nm of Au is deposited. After these depositions, the sample...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Assist ne please
Question 3 NAME: The circuit shown below contains two switches which open and close perfectly out of phase with one another (only one is open at any given time, and once one closes the other immediately opens, and vice-versa). The switches alternate at a frequency of 10kHz, and each switch spends 50% of the time open and 50% of the time closed (ie, each switch is open for 100 microseconds and then closed for 100 microseconds). The...
Item 1 In the case below, the original source material is given along with a sample of student work. Determine the type of plagiarism by clicking the appropriate radio button. Original Source Material Student Version But what are reasonable outcomes of the influence of global processes on education? While the question of how global processes influence all aspects of education (and who controls these forces) is multidimensional and not completely testable, there appear to be some theories of globalization as it...
Notes for lab dc02-Resistors and the Color Code will skip are Part 2 e, g: Part 4; Exercises 2, 4,5,6 and 3. It is important to answer the exercises correctly in each labl you should include the appropriate prefix for the unit in the Numerical Value We will not be Volt using the Volt-Ohm meter (VOM) for this lab, so skip the parts that ask for VOM measurements. The parts we You do need to complete Exercises1 Note that in...
Please see the articles below… 1. What is your opinion on the subject? 2. Which ethical views (i.e., utilitarian view, moral rights view, justice view, practical view) you feel are being used by both sides of the argument (i.e., for and against downloading) to justify their positions? High Court Enters File-Sharing Spat; Justices Must Determine Software Providers' Liability For Copyright Violations by Anne Marie Squeo. Wall Street Journal. (Eastern edition). New York, N.Y.: Mar 30, 2005. pg. A.2 WASHINGTON -- The Supreme...
Summarize this into 2 paragraph please it is an object of the present invention to provide systems and methods for timely conveying information from or about traffic control devices, such as stoplights and stop signs, to vehicles, e.g., as the vehicle approaches the traffic control device. In order to achieve this object and possibly others, a vehicular control arrangement in accordance with the invention includes at least one traffic control device and a communication system arranged in a vehicle and...