Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by...
Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern.
Pattern: TCCTATTCTT
Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT
Construct the table and a diagram of the FSM used by the KMP algorithm.
Homework Answers
Add Answer to:
Consider the problem of searching for genes in DNA sequences. A
DNA sequence is represented by...
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a...
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT a. Construct the good suffix table of the pattern for the Boyer-Moore algorithm. b. Apply Boyer-Moores algorithm to locate the pattern in the text c. Construct the table and a diagram of the FSM used by the KMP algorithm
b) Design a presorting-based algorithm to find the smallest possible mean of k elements in an array of n elements. Algorithm SmallestKMean (AI1. .n], k) c)Consider the problem of searching for genes...
b) Design a presorting-based algorithm to find the smallest possible mean of k elements in an array of n elements. Algorithm SmallestKMean (AI1. .n], k) c)Consider the problem of searching for genes in DNA sequences using Boyer-Moore string matching algorithm. A DNA sequence is represented by a text on the alphabet (A, C, G, T), and the gene or gene segment is the pattern. Construct the bad-symbol shift table and good-suffix shift table for the following gene segment: TAATAA Apply...
Genes are unique segements of A, T, C, and G sequences in our DNA. Each piece...
Genes are unique segements of A, T, C, and G sequences in our DNA. Each piece of our DNA contains many genes. The 46 human chromosomes contain around 20,000 genes. Gene 2 DNA molecule Linus Pauling's research was centered on the the function of one particular gene, the HBB gene. His data indicated that the cell uses the information in the HBB gene as a "recipe" to construct hemoglobin. The hemoglobin recipe in normal individuals was accurate so their cells...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented...
Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented as strings with characters in the set {A, G, C,T}. The similarity measure of r and y is defined as the maximum score of any alignment of r and y, where the score for an alignment is computed by adding substitution score and deletion and insertion scores, as explained below. (Some operations have negative scores.) The score for changing a character T, into a...
You decide to make a construct that places the DNA between the genes upstream to a...
You decide to make a construct that places the DNA between the
genes upstream to a reporter gene (GFP) in place of Gene 1. The
full-length construct has the correct expression pattern in
antennal discs. You then create several constructs that delete
sections of the upstream DNA and score them for expression. The
seven constructs are shown below; the black bars indicate the
region(s) deleted in each construct. The data table on the right
shows the expression results for each...
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides...
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides (A, T, C or G)? How many different “biological information” can be produced from a protein sequence consisting of 15 amino acids?
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT a. Construct the good suffix table of the pattern for the Boyer-Moore algorithm. b. Apply Boyer-Moores algorithm to locate the pattern in the text c. Construct the table and a diagram of the FSM used by the KMP algorithm
b) Design a presorting-based algorithm to find the smallest possible mean of k elements in an array of n elements. Algorithm SmallestKMean (AI1. .n], k) c)Consider the problem of searching for genes in DNA sequences using Boyer-Moore string matching algorithm. A DNA sequence is represented by a text on the alphabet (A, C, G, T), and the gene or gene segment is the pattern. Construct the bad-symbol shift table and good-suffix shift table for the following gene segment: TAATAA Apply...
Genes are unique segements of A, T, C, and G sequences in our DNA. Each piece of our DNA contains many genes. The 46 human chromosomes contain around 20,000 genes. Gene 2 DNA molecule Linus Pauling's research was centered on the the function of one particular gene, the HBB gene. His data indicated that the cell uses the information in the HBB gene as a "recipe" to construct hemoglobin. The hemoglobin recipe in normal individuals was accurate so their cells...
Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented as strings with characters in the set {A, G, C,T}. The similarity measure of r and y is defined as the maximum score of any alignment of r and y, where the score for an alignment is computed by adding substitution score and deletion and insertion scores, as explained below. (Some operations have negative scores.) The score for changing a character T, into a...
You decide to make a construct that places the DNA between the
genes upstream to a reporter gene (GFP) in place of Gene 1. The
full-length construct has the correct expression pattern in
antennal discs. You then create several constructs that delete
sections of the upstream DNA and score them for expression. The
seven constructs are shown below; the black bars indicate the
region(s) deleted in each construct. The data table on the right
shows the expression results for each...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
Most questions answered within 3 hours.
-
Break-even time. Hampton Corporation’s research
and development department is presenting a proposal for new product
research....
asked 15 seconds from now -
At Lake Itasca in Minnesota, the Mississippi river is only 25.0
feet wide. If you are...
asked 49 seconds ago -
A 2.0 μF parallel-plate air-filled capacitor is connected
across a 10 V battery.
(a) Determine the...
asked 11 minutes ago -
Write in Python This program:
1. Correct the compute_cells_state function which receives as
parameter an array...
asked 1 minute ago -
1. What is the difference in the output layer between a neural
network used for classification,...
asked 9 minutes ago -
ECO
2013 &
asked 15 minutes ago -
Insight refers to:
a.
Adaptive decision-making
b.
Credibility and trustworthness
c.
Understanding of one's problems
d....
asked 21 minutes ago -
Explain the differences between rights and permissions within
Windows. Define the principle of least privilege and...
asked 29 minutes ago -
A solid, frictionless cylindrical reel of mass M=5.00kg and
radius R=0.55m is used to draw water...
asked 31 minutes ago -
how do radio waves get emitted from Jupiter?
- do they come from radiation from planet...
asked 32 minutes ago -
The test statistic used in the F test for the equality of two
variances is calculated...
asked 43 minutes ago -
How does neutralisation of IL-6 trans-signaling affect the
autoimmune disease and inflammation? What if the trans-signaling...
asked 33 minutes ago