Listed below are the genome sizes (along with the total number of genes) for various organisms. Which genome has the largest gene density?
a. 68 Mb genome with 15,000 genes
b. 60,000 kb genome with 12,000 genes
c. 4.1 Mb genome with 3,500 genes
d. 20 Mb genome with 1,200 genes
e. 200 Mb genome with 14,300 genes
Answer: (c) 4.1 Mb genome with 3,500 genes
Explanation: The gene density of a genome is the ratio of the number of genes per number of base pairs, usually represented in million base pairs or megabase (Mb).
Calculating gene density for each set of given genome data:
Option (a) 68 Mb genome with 15,000 genes
Gene Density = 15000 / 68 = 220.58 genes/Mb
Option (b) 60,000 kb or 60 Mb genome with 12,000 genes
Gene Density = 12000 / 60 = 200 genes/Mb
Option (c) 4.1 Mb genome with 3,500 genes
Gene Density = 3,500 / 4.1 = 853.65 genes/Mb
Option (d) 20 Mb genome with 1,200 genes
Gene Density = 1,200 / 20 = 60 genes/Mb
Option (e) 200 Mb genome with 14,300 genes
Gene Density = 14,300 / 200 = 71.5 genes/Mb
Hence, Option (c) a genome with 853.65 genes/Mb has the largest gene density.
.
If you like my answer, please do not forget to thumbs up. I would be happy to discuss your concerns in the comment section below. Thank you!
Listed below are the genome sizes (along with the total number of genes) for various organisms....
A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...
Restriction Mapping Below is a restriction map for the plasmid PGEN101 (total length - 20 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting PGEN101 with the restriction enzymes EcoRI, BamHII, anda combination of EcoRI + BamHI. BamHI BamHI BamHI / PGEN101 (20 kb) Mb EcoRI Digest Performed Size Emments Obtained EcoRI........ BamHI.. EcoRI + BamHI.... Two freshmen college students, interested in becoming gene jocks, performed...
Genetic Linkage The six genes listed below are all located on Chromosome 2 of Drosophila melanogaster. Your goal is to construct a genetic map of Chromosome 2. That is, determine the order of these genes along chromosome 2 and the map distance in centimorgans between each gene. To complete this task, you will be given the results of a variety of two-point test crosses involving these genes. For each test cross you may assume that the female is heterozygous and...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Ch 1 1. Given the following dat Dec 31 Year 2 Dec 31 Year 1 Total liabilities S128,250 $120,000 Total stockholders oquity 95.000 80.000 compute the ratio of liabilities to stockholders' equity for each year Round to two decimal places 1.50 and 107, 11.35 and 1.50 respectively respectively 1.07 and 1.19. 1.1.19 and 1.35 respectively respectively The liabilities and stockholder's equity of a company are $132,000 and $244.000, respectively. Assets should equal SS188.00 $132.00 p $376,00 12.000 A financial statement...
Read about Cokes strategy in Africa in the article below and discuss the ethics of selling soft drinks to very poor people. Is this an issue that a company like Coke should consider? Africa: Coke's Last Frontier Sales are flat in developed countries. For Coke to keep growing, Africa is it By Duane Stanford Piles of trash are burning outside the Mamakamau Shop in Uthiru, a suburb of Nairobi, Kenya. Sewage trickles by in an open trench. Across the street,...
photos for each question are all in a row (1 point) In the following questions, use the normal distribution to find a confidence interval for a difference in proportions pu - P2 given the relevant sample results. Give the best point estimate for p. - P2, the margin of error, and the confidence interval. Assume the results come from random samples. Give your answers to 4 decimal places. 300. Use 1. A 80% interval for pı - P2 given that...