I was wondering if you could help me better understand
this Statistic problem about a spinner? I feel as though I am not
setting the problem up right. Would I use binomial
distribution?
Here is the problem: A spinner is spun 16 times. (picture a spinner
with four parts numbered 1, 2, 3 & 4)
(a) What is the probability of spinning fewer than four
three's?
(b) What is the mean of the distribution?
(c) what is the standard deviation?
(d) What is the probability of spinning seven three's instead of
four?
(e) What is the probability of spinning exactly four three's?
I greatly appreciate your help.
All the questions are asking on the probability of spinning three's so yes you can assume a binomial distribution here with probability of getting 3 treated as the success with p=1/4 and not getting 3 as q=3/4 assuming at each spin the chance of getting any number marked remains 1/4.
Attaching work below.
Once we view as the binomial it is pretty easy as you can see.
Hope you understood.
I was wondering if you could help me better understand this Statistic problem about a spinner?...
Hello! I am working on this genetics problem and was wondering if you could check my letter d. I am not sure if this mRNA sequence is correct and would really appreciate the help. Thank you! 4. A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following DNA: _3'_ CGCTAGCTGCTTCCTTGGGGA 5'_ coding strand/non-template ||||||||||||||||||| _5'_ GCGATCGACGAAGGAACCCCT _3'_ template strand/non-coding a) Which strand is the non-template strand? The top strand b) Which strand is a non-coding stand?...
Hi I am wondering if you would be able to help me with the following question please Let's say a county hospital has the mean defective units of 2000 with a stdev of 5. Let's say we take a random sample of 25 units and find the mean distribution of these defective units. What would be the mean and the standard deviation?
Help. I need help finding the solution along with explanations to better understand this problem. I would greatly appreciate it. Jorge owns two passive investments, Activity A and Activity B. He plans to dispose of Activity A in the current year or next year. Juanita has offered to buy Activity A this year for an amount that would produce a taxable passive activity gain to Jorge of $115,000. However, if the sale, for whatever reason, is not made to Juanita,...
I need help with my accounting questions and was wondering if you could help me? 1. Explain the differences between the following dates: Fiscal Start, Fiscal End, Earliest Transaction, Session, Latest Transaction and Historical Transactions. 2. Assume that mistake have been made in entering the history balances and the system has been changed to Ready. What are two ways to correct this problem?
I am wondering if you can help me out with these questions. I am very confused. 1. A math teacher gave her class two tests. While 70% of the class passed the first test and 75% of the class passed the second test, only 65% of the class passed both. Given that the students failed the first test, what probability of those will passed the second test? 2. In the game of roulette, a player can place a $5 bet...
14.) Hello. I am in desperate need of help for this problem. Could you be kind enough to help in the most simple, easy to understand steps so that I may follow along please? I don't know the steps. Thank you so much!!! 14. Problem 14 has two parts: 14. A. C. If the circular wire in horizontal plane is placed in an increasing downward magnetic field, a) what is the direction of the induced magnetic field and b) what...
Can you please help me answer and understand this problem? I will rate your answer! Thank you! The shape of the distribution of the time required to get an oil change at a 20 minute oil change facility is unknown. However, records indicate that the mean time is 214 minutes, and the standard deviation is 35 minutes. Complete parts (a) through (c) (a) To compute probabilities regarding the sample mean using the normal model, what size sample would be required?...
Can you help me with the following problem, if you could leave all the steps clearly for me to have a better understanding :) Problem A personnel manager is interviewing potential employees in order to fill two vacancies. The probability that the interviewee has the necessary qualities and accepts an offer is 0.8. a) What is the probability that it will be necessary to interview exactly four people? b) What is the probability that it will be necessary to interview...
Please help me understand these different distributions! I will kindly rate. Q2 Multiple Choice You are going fishing. For each of the following random variables, select the distribution (Binomial, Geometric, Poisson, Exponential, or Normal) that best characterizes or approximates it. Q2.1 You catch an expected number of 1.5 fish per hour. You can catch a fish at any instant of time. Which distribution best characterizes the number of fish you catch in one hour of fishing? O Binomial O Geometric...
i do not understand why b and c are wrong can someone help me please... Recycling trash, reducing waste, and reusing materials are eco-actions that will help the environment. According to a USA Today snapshot, 78% of respondents list recycling as the leading way to help our environment. Suppose that a random sample of n = 100 adults is selected and that the 78% figure is correct. Top Eco-acti. Talente Help the Environment Survey respondents say recycling trash, reducing waste,...