Given: TTGGGTTAGGGTTAGGGTTAGGA What is the probability that the specific sequence required to form a protein structure...
Given: TTGGGTTAGGGTTAGGGTTAGGA
What is the probability that the specific sequence required to form a protein structure occurs randomly in any given DNA? Assume that all four DNA nucleotide bases (A, T, C and G) are equally probable and nucleotides are present in excess.
Homework Answers
Probability of any DNA base = 1/4 = 0.25
Now the sequence is = TTGGGTTAGGGTTAGGGTTAGGA
Total DNA base = 23
Probability of any specific 23 base DNA will be = (1/4)23 = (0.25)23 = 1.42109E-14
Add Answer to:
Given: TTGGGTTAGGGTTAGGGTTAGGA
What is the probability that the specific sequence required to
form a protein structure...
At a specific area of a chromosome, the sequence of nucleotides below is present where the...
At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opened to form a replication fork: 3' C C T A G G C T G C A A T C C 5' A 7-nucleotide RNA primer is formed starting at the underlined T (T) of the template. What is the primer sequence, including 5' and 3' end? The "T" in bold is the underlined T.
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that a...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that assumes that from one time step to the next, the probability that the nucleotide remains unchanged equals 1-3α, for some α, 0 < α < 1 . If it does change (i.e., the nucleotide undergoes mutation), then it can change to any of...
A. What is a nucleotide? What are the subunits of nucleotide? B. What is a nitrogen...
A. What is a nucleotide? What are the subunits of nucleotide? B. What is a nitrogen base? Name the four nitrogen bases in DNA (A, C, G, T….remember the full names). C. Explain the structure of DNA, why is it referred as Watson and Crick model? Given a sequence of DNA, you should be able to find its complementary nitrogen bases.For example the complementary nitrogen bases for AGTCGC sequence is D. What is RNA? How many kinds of RNA, (mRNA,...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
17. When testing for current in a cable with seven color-coded wires, the author used a...
17. When testing for current in a cable with seven color-coded wires, the author used a meter to test three wires at a time. How many different tests are required for every possible pairing of three wires? The number of tests required is____ 18. DNA (deoxyribonucleic acid) is made of nucleotides. Each nucleotide can contain any one of these nitrogenous bases: A (adenine), G (guanine), C (cytosine), T(thymine). If one of those four bases (A, G, C, T) must be...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site....
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site. It has the and is responsible for identifying the precise nucleotide at which TATA box, TATAAA, transcription Pribnow box, TATAAT, transcription 0 0 0 0 0 Pribnow box, TATAAT, translation Pribnow bow, TTGACA, translation None of the answers are correct Ribosomes are made of: 1. rRNA 2. proteins 3. URNA 3 2 Both 1 and 2 are correct All answers are correct 1 Once...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that assumes that from one time step to the next, the probability that the nucleotide remains unchanged equals 1-3α, for some α, 0 < α < 1 . If it does change (i.e., the nucleotide undergoes mutation), then it can change to any of...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the sequence on at RNA is UAC. then the sequence on the mRNA is: A. AUG B. UAC C.ATG D. CAUWhat happens at the "P" site on the ribosome? A. A peptide bond is formedB. A protein is released C. The ribosome prepares for translation D. There is no...
In prokaryotes the consensus sequence begins. is located about 10 bases upstream from the initiation site. It has the and is responsible for identifying the precise nucleotide at which TATA box, TATAAA, transcription Pribnow box, TATAAT, transcription 0 0 0 0 0 Pribnow box, TATAAT, translation Pribnow bow, TTGACA, translation None of the answers are correct Ribosomes are made of: 1. rRNA 2. proteins 3. URNA 3 2 Both 1 and 2 are correct All answers are correct 1 Once...
Most questions answered within 3 hours.
-
The activation energy for a given reaction is 50.3 kJ/mol. If
the rate constant for the...
asked 47 minutes ago -
An entomologist discovers a dung beetle rolling a ball of dung
along the ground, and decides...
asked 2 hours ago -
Humans have used horses for transportation for millions of
years. Therefore, they will use horses for...
asked 4 hours ago -
The following are the Jensen Corporation's unit costs of making
and selling an item at a...
asked 4 hours ago -
Does direct Medicare reimbursement of Advanced practice nurses
increase access to their services?
asked 5 hours ago -
List and explain why a company would choose to use a
published
compensation survey vs. creating...
asked 5 hours ago -
A discrete random variable X can take values from 1 to 10. Find
the variance of...
asked 6 hours ago -
The primary financial goal of a corporation is to maximize:
shareholders wealth.
earnings per share.
stock...
asked 6 hours ago -
determine whether the vectors u=(1,2,3,), v=(-2,1,0) and
w=(1,0,1) are linearly dependent or independent.
asked 6 hours ago -
python
Define a function called print_values which takes a dictionary
object as a parameter. The function...
asked 7 hours ago -
In Chapter 1 you created a program named Triangle in
which you displayed a seven-line triangle...
asked 7 hours ago -
Research question: What are the differences between separately
stated and non separately stated transactions in an...
asked 7 hours ago