ZuoTi.Pro
Question

1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b....

1. which tripeptide will most likely line the opening of a Cl- channel?
a. His-Lys-Arg
b. Gly-Pro-Arg
c. Asp-Trp-Tyr
d. Asp-Ala-Glu
e. Leu-Val-Phe
2. Which tripeptide will most likely line the opening of a K+ channel? (consider side chains at physiological pH)
a. His-Lys-Arg
b. Gly-Pro-Arg
c. Asp-Trp-Tyr
d. Asp-Ala-Glu
e. Leu-Val-Phe
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer (1)=(d)Asp-Ala-Glu

Explanation=Opening of chloride channel is regulated by Glutamate.

Now consider other option-

Rest the option's peptide do not contain glutamate so all are wrong option.

0 0
Add a comment
Know the answer?
Add Answer to:
1. which tripeptide will most likely line the opening of a Cl- channel? a. His-Lys-Arg b....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-I

    Which of these protein sequences is most likely to span a cell membrane? Gly-Asp-Val-Ala-Gly-Arg-Gly-Asn-Gly-Lys-Lys-Pro-Ser-Ser-Val-Arg-Ala-Leu-Ser Ile-Val-Leu-Pro-Ile-Val-Leu-Leu-Val-Phe-Leu-Cys-Leu-Gly-Val-Phe-Leu-Leu-Trp Lys-Asn-Trp-Arg-Leu-Lys-Asn-Ile-Asn-ser-Ile-Asn-Phe-Asp-Asn-Pro-Val-Tyr-Gln A. 773 B. 792 C. 811

  • What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe...

    What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...

  • How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...

    How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu

  • A small generic section of the primary structure of an α helix is given by −amino...

    A small generic section of the primary structure of an α helix is given by −amino acid1−amino acid2−amino acid3−amino acid4−amino acid5−amino acid6−amino acid7− Which amino acid residue's backbone forms a hydrogen bond with the backbone of the third (3rd) residue? Which peptide segment is most likely to be part of a stable α helix at physiological pH ? −Glu−Leu−Ala−Lys−Phe− −Gly−Arg−Lys−His−Gly− −Gly−Gly−Gly−Ala−Gly− −Pro−Leu−Thr−Pro−Trp− −Lys−Lys−Ala−Arg−Ser− −Glu−Glu−Glu−Glu−Glu− −Tyr−Trp−Phe−Val−Ile−

  • How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This pe...

    How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This peptide yields the following results when broken down into smaller fragments Please note the AA are given in alphabetical order). Show your work, explain your reasoning, give the answer in three letter abbreviation and one letter abbreviation Fragment Content His Treatment Edman Chymotrypsin Gly. His, Phe Ser, Tyr Arg2, Leu, Lys, Ser.Ala, Phe Trp, Val Gly, His, Lys,...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

  • A small generic section of the primary structure of an alpha helix is given below -amino...

    A small generic section of the primary structure of an alpha helix is given below -amino acid1-amino acid2-amino acid3-amino acid4-amino acid5-amino acid-6-amino acid7- a.) which amino acid residue's backbone forms a hydrogen bond witht he backbone of the seventh(7th) residue? 6, 1, 3, 2, 5, OR 7? b.) which of the following peptide segments is most likely to be part of a stable alpha helix at physiological pH? a.) -Lys-Lys-Ala-Arg-Ser- b.) -Gly-Arg-Lys-His-Gly- c.) -Pro-Leu-Thr-Pro-Trp- d.) -Gly-Gly-Gly-Ala-Gly- e.) -Glu-Glu-Glu-Glu-Glu- f.) -Glu-Leu-Ala-Lys-Phe-...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments...

    On your internship, you visit the Mass Spectrometry Lab. Mass spectrometry can identify short peptide fragments based on their molecular weights. Your fellow intern Jerry has neglected to label his tubes of amyloid beta peptide 42 after digesting them with some proteases that we learned about in Module 6: pepsin, trypsin, and chymotrypsin. Help him figure out what protease is in each tube. Jerry’s supervisor has the fragments listed in the same order as the original peptide primary sequence, which...

  • How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys,...

    How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This peptide yields the following results when broken down into smaller fragments Please note the AA are given in alphabetical order). Show your work, explain your reasoning, give the answer in three letter abbreviation and one letter abbreviation Fragment Content His Treatment Edman Chymotrypsin Gly. His, Phe Ser, Tyr Arg2, Leu, Lys, Ser.Ala, Phe Trp, Val Gly, His, Lys,...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT