What does the enzyme reverse transcriptase do? A) Using the amino acid sequence of a protein...
What does the enzyme reverse transcriptase do?
A) Using the amino acid sequence of a protein as a template, it
makes an RNA molecule.
B) Using RNA as a template, it makes a DNA molecule.
C) Using RNA as a template, it makes an RNA molecule.
D) Using DNA as a template, it makes an RNA molecule.
E) Using DNA as a template, it makes a DNA molecule.
Homework Answers
I believe the correct answer to be:
Option B) Using the RNA as a template, it makes a DNA molecule.
It is generally used by the viruses to incorporate their genetic information that is present in RNA form into the DNA of the host by converting their RNA information into DNA information.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
What does the enzyme reverse transcriptase do?
A) Using the amino acid sequence of a protein...
Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a...
Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a hybrid molecule with one DNA stranded base-paired to the complementary RNA strand. synthesize double-stranded RNA. direct the production of DNA from a single-stranded RNA genome. transcribe mRNA from a DNA genome. synthesize sense-stranded mRNA from an antisense RNA genome.
What does the enzyme reverse transcriptase do? How might that be useful for studying RNA viruses...
What does the enzyme reverse transcriptase do? How might that be useful for studying RNA viruses like SARS-CoV-2?
7) What enzyme does a retrovirus use to make viral DNA? A) Reverse transcriptase B) DNA...
7) What enzyme does a retrovirus use to make viral DNA? A) Reverse transcriptase B) DNA polymerase C) Transcriptionase D) RNA polymerase 8) Pyruvate contains how many carbon atoms? A) 3 B) 4 C) 5 9) Which of the following contains the vitamin niacin, B3, as part of its structure? A) NADH B) ATP C) Coenzyme Q D) 6 D) FADH2 10) The final product of aerobic glycolysis is: A) lactate B) ethanol C) acetyl COA D) pyruvate
A specific stretch of DNA that programs the amino acid sequence of a protein is a...
A specific stretch of DNA that programs the amino acid sequence of a protein is a A. nucleic acid B. protein C. gene D. enzyme
20. Protein amino acid side chains can hydrogen bond in the major groove of DNA, and...
20. Protein amino acid side chains can hydrogen bond in the major groove of DNA, and discriminate between each of the four possible base pairs. In which one of the following groups of amino acids can all three members potentially be used in such DNA-protein recognition? A) Ala, Asn, Glu B) Arg. Gin, Leu C) Asn, Gin, Trp D) Asn, Glu, Lys E) Glu, Lys, Pro 21. Compared with DNA polymerase, reverse transcriptase: A) does not require a primer to...
HIV uses the reverse transcriptase enzymes to make A, Dna from a dna template B. Dna...
HIV uses the reverse transcriptase enzymes to make A, Dna from a dna template B. Dna from an rna template c. rna from an rna template d rna from a dna template
HIV's genome of RNA includes the code for reverse transcriptase (RT), an enzyme that acts early...
HIV's genome of RNA includes the code for reverse transcriptase (RT), an enzyme that acts early in infection to synthesize a DNA genome off of an RNA template. The HIV genome also codes for protease (PR), an enzyme that acts later in infection by cutting long viral polyproteins into smaller, functional proteins. Both RT and PR represent potential targets for antiretroviral drugs. Drugs called nucleoside analogs (NA) act against RT, whereas drugs called protease inhibitors (PI) act against PR. Which...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process in which mRNA is used as a template (b)Where in the cell does this process occur? Q4 carries amino acids to the ribosome for protein synthesis. Q5 Give the complementary DNA sequence to AGGCTATTCATT. Q6 Give the complementary RNA sequence to AGGCTATTCATT. Q7 Use Table 9.4 to give the amino acid sequence that results from the above RNA. Q8 What are two differences betweeen...
11. What is the first amino ackd of any initial protein that is A. Valine C....
11. What is the first amino ackd of any initial protein that is A. Valine C. Lysine D. Tryptophan E. Methionine 12. Choose all that apply. Polymerase Chain Reaction (PCR) can be used to A Create a DNA profile of suspects, victims, and criminals during crime scene investigations B. Duplicate pieces C. Help determine paternity D. Stimulate cell division E. Stimulate gene expression of DNA into many copies using a special form of DNA polymerase 13. What occurs during transcription?...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
7) What enzyme does a retrovirus use to make viral DNA? A) Reverse transcriptase B) DNA polymerase C) Transcriptionase D) RNA polymerase 8) Pyruvate contains how many carbon atoms? A) 3 B) 4 C) 5 9) Which of the following contains the vitamin niacin, B3, as part of its structure? A) NADH B) ATP C) Coenzyme Q D) 6 D) FADH2 10) The final product of aerobic glycolysis is: A) lactate B) ethanol C) acetyl COA D) pyruvate
20. Protein amino acid side chains can hydrogen bond in the major groove of DNA, and discriminate between each of the four possible base pairs. In which one of the following groups of amino acids can all three members potentially be used in such DNA-protein recognition? A) Ala, Asn, Glu B) Arg. Gin, Leu C) Asn, Gin, Trp D) Asn, Glu, Lys E) Glu, Lys, Pro 21. Compared with DNA polymerase, reverse transcriptase: A) does not require a primer to...
(b)Where in the cell does this process occur? Q3 to create a protein. is the process in which mRNA is used as a template (b)Where in the cell does this process occur? Q4 carries amino acids to the ribosome for protein synthesis. Q5 Give the complementary DNA sequence to AGGCTATTCATT. Q6 Give the complementary RNA sequence to AGGCTATTCATT. Q7 Use Table 9.4 to give the amino acid sequence that results from the above RNA. Q8 What are two differences betweeen...
11. What is the first amino ackd of any initial protein that is A. Valine C. Lysine D. Tryptophan E. Methionine 12. Choose all that apply. Polymerase Chain Reaction (PCR) can be used to A Create a DNA profile of suspects, victims, and criminals during crime scene investigations B. Duplicate pieces C. Help determine paternity D. Stimulate cell division E. Stimulate gene expression of DNA into many copies using a special form of DNA polymerase 13. What occurs during transcription?...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
Most questions answered within 3 hours.
-
An entomologist discovers a dung beetle rolling a ball of dung
along the ground, and decides...
asked 1 hour ago -
Humans have used horses for transportation for millions of
years. Therefore, they will use horses for...
asked 3 hours ago -
The following are the Jensen Corporation's unit costs of making
and selling an item at a...
asked 3 hours ago -
Does direct Medicare reimbursement of Advanced practice nurses
increase access to their services?
asked 4 hours ago -
List and explain why a company would choose to use a
published
compensation survey vs. creating...
asked 4 hours ago -
A discrete random variable X can take values from 1 to 10. Find
the variance of...
asked 5 hours ago -
The primary financial goal of a corporation is to maximize:
shareholders wealth.
earnings per share.
stock...
asked 5 hours ago -
determine whether the vectors u=(1,2,3,), v=(-2,1,0) and
w=(1,0,1) are linearly dependent or independent.
asked 5 hours ago -
python
Define a function called print_values which takes a dictionary
object as a parameter. The function...
asked 6 hours ago -
In Chapter 1 you created a program named Triangle in
which you displayed a seven-line triangle...
asked 6 hours ago -
Research question: What are the differences between separately
stated and non separately stated transactions in an...
asked 6 hours ago -
By using Arduino write a code that connects two LEDs to two
push-buttons. Each button controls...
asked 7 hours ago