Question

Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of...

Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of function may be encoded in a particular region of the genome. Which statement is true regarding sequence motifs?

Sequence motifs are found in DNA and in corresponding RNA produced by transcription.
Sequence motifs are telltale sequences of nucleotides that indicate possible function.
An open reading frame (ORF) is a type of sequence motif.
Sequence motifs help identify sequences that encode protein-coding genes.
All of these choices are correct.
0 0
Add a comment Improve this question Transcribed image text
Answer #1
  • All of these choices are correct.
    • Sequence motifs are found in DNA and in corresponding RNA produced by transcription.
    • Sequence motifs are telltale sequences of nucleotides that indicate possible function.
    • An opening frame (ORF) is a type of sequence motif.
    • Sequence motifs help identify sequences that encode protein coding genes.

​​​​​​​ In genome annotation,the sequence motif which identifies the location as potentially or probable protein coding.And the sequence motif can be found in DNA itself or in the RNA sequence that are deduced from the DNA sequence.

Add a comment
Know the answer?
Add Answer to:
Sequence motifs are the sequences of nucleotides that indicate what types of function or absence of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1.) Which of the following is false? a.) The high degree of identical sequences between two...

    1.) Which of the following is false? a.) The high degree of identical sequences between two people make finding DNA differences very difficult b.) The high amount of repeated regions in the human genome make it difficult to sequence and assemble c.) SNP comparisons require a reference where polymorphism sites are established within a population d.) Copy number variation can be identified by restriction enzymes in DNA fingerprinting assays e.) All of these statements are true. -    2.) What...

  • The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have...

    The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have a circular genome of 8.7 x106base pairs (bp).  Open reading frame (ORF) analysis indicated the presence of 7,250 ORFs that encode proteins with an average length of 360 aa.    What is the information content of this genome (i.e.– how much information can be encoded in this length of DNA)?  Since the genetic code can be considered digital in nature, convert the information content of base pairs...

  • The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have...

    The genome of a newly discovered bacterial species (Bacillus sanfranciscus) is sequenced and found to have a circular genome of 8.7 x 106 base pairs (bp). Open reading frame (ORF) analysis indicated the presence of 7,250 ORFs that encode proteins with an average length of 360 aa.   a. What is the information content of this genome (i.e. – how much information can be encoded in this length of DNA)?Since the genetic code can be considered digital in nature, convert the...

  • Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods...

    Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...

  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • Overview The purpose of this activity is to help the students to understand how replication, tran...

    TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process...

    pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process B) an enzyme that uses RNA as a substrate C) an enzyme that catalyzes the association between the large and small ribosomal subunits D) an enzyme that synthesizes RNA primers during DNA replication E) an RNA with enzymatic activity 20) What is a ribozyme? 21) 21) Alternative RN A splicing A) increases the rate of transcription. B) can allow the production of similar proteins...

  • want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the...

    want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT