How are copies of a DNA amplicon made after the amplicon inserted into a cloning vector?
How are copies of a DNA amplicon made after the amplicon inserted into a cloning vector?
Homework Answers
cloning vector is extra chromosomal , self replicating DNA molecule which can replicate independently in host cell. it has its own origin of replication site and make more than one copies in same host cell. we can insert other DNA molecule by deleting some region from vector molecule.
when we insert our DNA amplicon in cloning vector it replicate with vector molecule. number of copies of our amplicon is depend upon number of replication cycles of cloning vector
in this way copies of DNA amplicon are made after amplicon inserted into cloning vector.
Add Answer to:
How are copies of a DNA amplicon made after the amplicon
inserted into a cloning vector?
18. Describe the process of DNA cloning. What do we need? Describe what a vector is....
18. Describe the process of DNA cloning. What do we need? Describe what a vector is. Describe what the vector needs to have to be a good vector. How do you know when it works? Make sure to describe how we make recombinant DNA. I
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at...
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at random back into the genome. Some genomes can be composed almost entirely of Tes. Given the above what do you predict about the relationship between the number of TEs in a genome and population size
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at...
Transposable elements (TEs) are sequences of DNA that make copies of themselves, which are inserted at random back into the genome. Some genomes can be composed almost entirely of Tes. The Tes might be harmful. what do you predict about the relationship between the number of TEs in a genome and population size
You are interested in cloning a particular segment of DNA and wish to use a commercial...
You are interested in cloning a particular segment of DNA and wish to use a commercial cloning vector with a BamHI cloning site. However, your segment of DNA does not contain the appropriate restriction site. Discussing your problem with a colleague they suggest using PCR to address your problem. How can you use a PCR reaction to facilitate a successful cloning?
50. Viral DNA is an important cloning vector because it can typically be combined with relatively...
50. Viral DNA is an important cloning vector because it can typically be combined with relatively large pieces of DNA. sestamog AMO True / False BSW 51. When bacteria are genetically modified to produce a protein product, technical difficulties arise because that product is not always secreted from the cell. True / False 52. Yeasts cannot express foreign, eukaryotic genes. True / False
Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b....
Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b. Multiple Cloning Site c. Origin of replication d. Resistance gene e. Promoter region
1. Molecular cloning has made it possible to take a DNA fragment from nuclear DNA, containing...
1. Molecular cloning has made it possible to take a DNA fragment from nuclear DNA, containing an entire gene, and insert it into a cloning plasmid just behind a phage promoter. This means that the cloned gene can be transcribed in a test tube using a commercially available phage RNA polymerase protein. If you were to use agarose gel electrophoresis to separate RNA according to size, would the RNA produced in the test tube show any differences with RNA from...
"In genetic modifications, DNA inserted can come from _____ ." any organism containing the DNA of...
"In genetic modifications, DNA inserted can come from _____ ." any organism containing the DNA of interest only the same plasmid as the vector only the same species as the vector only the same species as the host only the same phylum as the plasmid vector
You want to generate billions of copies of a DNA fragment (sequence) consisting of ONLY the...
You want to generate billions of copies of a DNA fragment
(sequence) consisting of ONLY the bracketed sequence in the DNA
molecule below. Even though in “real life” we use primers around 20
bases long, let’s suppose for this example that 3 base long primers
will work successfully. Which of the following primers will work to
generate your PCR amplicon (DNA fragment)?
5'-AATGAGCCATC[CCATATAAGCCGCGAGTTTG CATGTAC---3' O 5'CCA3' alone O 5'CCA3' and 5'CAA3' O 5'TGG3' and 5'TTG3' O S'ATC3' and 5'TAC3' O...
1. Explain how bacterial cloning can help increasing the amount of DNA (DNA amplification) and when...
1. Explain how bacterial cloning can help increasing the amount of DNA (DNA amplification) and when it is implemented in science or in medicine. Use a diagram if needed.
18. Describe the process of DNA cloning. What do we need? Describe what a vector is. Describe what the vector needs to have to be a good vector. How do you know when it works? Make sure to describe how we make recombinant DNA. I
50. Viral DNA is an important cloning vector because it can typically be combined with relatively large pieces of DNA. sestamog AMO True / False BSW 51. When bacteria are genetically modified to produce a protein product, technical difficulties arise because that product is not always secreted from the cell. True / False 52. Yeasts cannot express foreign, eukaryotic genes. True / False
You want to generate billions of copies of a DNA fragment
(sequence) consisting of ONLY the bracketed sequence in the DNA
molecule below. Even though in “real life” we use primers around 20
bases long, let’s suppose for this example that 3 base long primers
will work successfully. Which of the following primers will work to
generate your PCR amplicon (DNA fragment)?
5'-AATGAGCCATC[CCATATAAGCCGCGAGTTTG CATGTAC---3' O 5'CCA3' alone O 5'CCA3' and 5'CAA3' O 5'TGG3' and 5'TTG3' O S'ATC3' and 5'TAC3' O...
Most questions answered within 3 hours.
-
How can I solve the following using a TI83
Claim: Most adults would erase all of...
asked 20 seconds from now -
Which VALS segment is most likely to have a top of the line
brand new (2015)...
asked 39 seconds ago -
Write a program to score the paper-rock-scissor game. Each of
two users types in either P,R...
asked 20 minutes ago -
Calculate the equillibrium constent K for a redox reaction that
has E°cell = -.98 V at...
asked 32 minutes ago -
A concave spherical mirror has a radius of curvature of
magnitude 19.6 cm.
(a) Find the...
asked 34 minutes ago -
3. draw a diagram of the magnetic field:
a. around a long straight wire with a...
asked 33 minutes ago -
If you titrated 30.0 mL of 0.1 M HCl with 0.1 M NaOH, indicate
the approximate...
asked 41 minutes ago -
NADH passes electrons into the electron transport chain. List
the carriers that would receive the electrons,...
asked 49 minutes ago -
A cylindrical cable with a resistivity of 1.6x10-8 Ω·m and cross
sectional area of 3x10-5 m^2...
asked 49 minutes ago -
True or False.
A consumer with convex preferences who is indifferent between
the bundles (5,2) and...
asked 53 minutes ago -
A diamond's index of refraction for red light, 656 nm, is 2.410,
while that for blue...
asked 1 hour ago -
Compare HPLC, SPE, and GC. Identify the differences, the
advantages, and the weaknesses of each method.
asked 1 hour ago