Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b. Multiple Cloning Site c. Origin of replication d. Resistance gene e. Promoter region
c should be the correct option
Foreign DNAs are inserted into a vector at a region called the origin of replication, An origin of replication is a sequence of DNA at which replication is initiated on a chromosome, plasmid or virus.
HOPE MY ANSWER HELP YOU
ALL THE BEST
Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b....
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob a gene encoding resistance to an antibiotic. a gene encoding reverse transcriptase. O a multiple-cloning site. O e the lacZ gene (or a variation thereof).
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
Which of the following characteristic is not present in a plasmid on a general basis?a) Multiple cloning site (MCS)b) Origin of replication (ori)c) Antibiotic resistance gened) Beta galactose genes
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from cells expressing the gene. Include how you would amplify the specific gene and how you would select for bacterial cells containing the cloned gene if the gene was inserted into a multiple cloning site within the lacZ gene on a plasmic. If you wanted to later express the gene using a eukaryotic expression vector and promoter how would you ensure the gene was in...
You wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer's market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in the hope of cloning the harЕ gene. If you succeed you will be a...
The basic structure of a gene contains which of the following? A) amino acids as specified by the DNA sequence B) an origin of replication C) a transcriptional termination site D) a promoter E) a site where sigma is released
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
8. In transcription, A) mRNA is synthesized from DNA B) the starting point of synthesis is the promoter site C) RNA polymerase binds to the promoter during initiation D) the ending point of synthesis is the terminator site E) All of the above The tryptophan (trp) operon is actively transcribed (i.e. gene expression occurs) A) when there is excess tryptophan in the cell. B) when there is a lack of tryptophan in the cell. C) constitutively because the trp operon...
BioLoG 11. chose the order below that most closely represents the order in which the following proteins participate in DNA replication. a. helicase, single stranded binging protein, primase DNA polymerase b. single -stranded binding protein, primase DNA polymerase helicase c. primase, DNA polymerase, single- stranded binding protein, helicase d. helicase, single- stranded binding protein DNA polymerase, primase. 12. what is the function of the enzyme primase during DNA replication? a. to unwind the double helix to prime it for replication...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...