Which of the following characteristic is not present in a plasmid on a general basis?
a) Multiple cloning site (MCS)
b) Origin of replication (ori)
c) Antibiotic resistance gene
d) Beta galactose genes
Answer: d
Explanation: Plasmid generally consists of characteristics such as multiple cloning site, origin of replication, antibiotic resistant genes and beta galactosidase genes. An origin of replication is necessary for the replication to take place.
Plasmids are used for carrying out the cloning procedure. Which of the statement is true for plasmids?a) Bacterial plasmids are linear in natureb) They are single strandedc) Insertion of DNA into plasmid allows it to be propagated in host cells and they are known as vectors because of their this propertyd) They are not capable of replication in bacteria
Antibiotic selection allows you to determine which bacteria contain the plasmid of interest, but do not necessarily tell you if the plasmid has taken up the recombinant DNA and contains your gene of interest. Which gene, which spans the multiple cloning site (MCS), allows you to screen for plasmids that contain your insert? A. β-lactamase (bla) B. Ori C. lacZ D. X-gal
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob a gene encoding resistance to an antibiotic. a gene encoding reverse transcriptase. O a multiple-cloning site. O e the lacZ gene (or a variation thereof).
The plasmid pFR55 is a useful vehicle for the cloning of any DBA sequence in E. coli. A restriction map of pFR55 showing the restriction enzyme cutting sites is shown below. The plasmid can replicate I'm E. coli and carries the tetracycline resistance Tc and ampicillin resistance (Ap) genes for use as selectable markers in E. coli. a. you wish to insert a gene into the SalI site of pFR55. How would you select for E. Coli cells that have...
Explain briefly (and within the context of the plasmid you just created) the role of each of the 10 elements that are in bold it needs a “ColE1 origin” (E. coli origin of replication) · it needs a “2μ ori” (yeast origin of replication) · a AmpR gene (coding for the bacterial resistance against the antibiotic ampicillin) and its promoter. · a yeast gene coding for the synthesis of uracil and its promoter. · a yeast gene coding for the...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
Q1) What is the size of the entire pOTC-Δ plasmid (in units of base pairs, bp)? Simply input one NUMBER with no spaces, punctuation or units. Make sure you write the number in digits not words (1 mark) Q2) What are the selection markers for the pOTC-Δ plasmid? (1 mark) Select one: a. Hygromycin resistance gene b. NdeI c. NdeI and KpnI d. Ampicillin resistance gene e. Ampicillin resistance gene and the hygromycin resistance gene f. pUC Ori and OTC-Δ...
Question 4 C. Cloning and restriction enzyme digest Video aid 1: Plasmid cloning Video aid 2: Restriction enzyme digest analysis The PCR was a success and your target region of 440 bp in length has been amplified. You igate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below Bamll 300 EcoRI 3400 1000 2000 5...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
7. Explain the procedure for cloning DNA fragment into the plasmid PBR322 (shown on the right) (S pts.). The gene fragment of interest was obtained by digestion of chromosomal DNA with the restriction enzyme Sall and subsequent purification using agarose gel electrophoresis. Which antiblotic would you use in the final step of the cloning procedure, and Pst why? EcoR Sal Ampicillin Tetracycline resistanica(Ter Amp) PBR322 4,361 bp) Origin of replicatiorn (ori Pvull 8. Assume that your gene fragment from question...