Which of the following is IMPROBABLE? WHY? A hydrogen bond between the side chains of glutamate...
Which of the following is IMPROBABLE? WHY?
- A hydrogen bond between the side chains of glutamate with the side chain of serine
- An ionic bond with between the side chains of lysine and aspartate
- Hydrophobic interactions between the side chains of leucine and isoleucine
- Salt bridges between alanine and histidine
- A backbone hydrogen bond between C=O on one amino acid with the N-H of another amino acid 4 residues away.
Homework Answers
Add Answer to:
Which of the following is IMPROBABLE?
WHY?
A hydrogen bond between the side chains of glutamate...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The...
options
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
i think it might be Glutamate, but im not sure. Someone please help!! its the last...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions?...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysi...
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
Which of the following amino acid side chains can form hydrogen bonds with each other?
Which of the following amino acid side chains can form hydrogen bonds with each other? Isoleucine Leucine Glutamic acid Aspartic acid Lysine Asparagine Arg & Leu Val & Asn Asn & Ser Ser & Val Val & lle
B) If this mRNA is translated beginning with the first AUG codon in its sequence, what is...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
1.) Draw examples of the following hydrogen-bond interactions: A hydrogen bond between the backbone of a...
1.) Draw examples of the following hydrogen-bond interactions: A hydrogen bond between the backbone of a polypeptide. A hydrogen bond between a serine residue and a polypeptide back bone. A hydrogen bond between 2 amino acid side chains. 2.) Which of the following functional groups do NOTparticipate in hydrogen bonding: A Methyl Group A Carbonyl Group A Hydroxyl Group An Amino Group For the groups above which can form hydrogen bonds, draw an example of it acting as a hydrogen...
Answer the following questions based upon a tripeptide sequence with the following amino acids: S L...
Answer the following questions based upon a tripeptide sequence with the following amino acids: S L D Serine Leucine Aspartate a) What is the overall charge of the most abundant tripeptide species at neutral pH (pH 7.0)? b) At physiological pH, what is the best desciption of the chemical properties of the side chain of each amino acid? options are: hydrophobic, polar uncharged, negativelly charged, and positively charged c) What is the overall charge of the most abundant tripeptide...
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
options
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
Which of the following amino acid residues are often involved in proton transfers in enzyme-catalyzed reactions? Select one: Histidine, aspartate, lysine, and serine Histidine, aspartate, glutamate, arginine, and lysine. Glutamine, asparagine, lysine, and tyrosine Histidine, aspartate, serine, and cysteine Serine, tyrosine, arginine, and cysteine
26. Which of the following classification does not match the amino acid side chain A) Contains an basic group/ lysine B) It is polar C) Forms disulfide bond/ cysteine D) Forms hydrogen bonds with neighbors/ alanine serine 27. All amino acids found in proteins are L-amino acids EXCEPT the achiral. A) glutamate B) Lysine C) glyeine D) Alamine 28. The plH at which the positive and negative charges of an amino acid balance each ofher is called the A) isotonic...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Most questions answered within 3 hours.
-
D. A student completed 20 courses in the School of Arts and
Sciences. Her grades in...
asked 1 hour ago -
teo
pucks moving on a frictionless air table are about to collide. the
1.5 kg puck...
asked 1 hour ago -
Problem #1
The area between Z = 0 and Z = 2.50
The area between Z...
asked 3 hours ago -
1. What is the meaning of the term communication style?
2. What are the benefits to...
asked 2 hours ago -
9.) You are buying a car that cost $26,500. You make payments of
$412 each month...
asked 2 hours ago -
. Suppose a discrete random variable has probability
distribution
P(x) = .2 if x = 0...
asked 4 hours ago -
Under the influence of its drive force, a snowmobile is moving
at a constant velocity along...
asked 4 hours ago -
Why do organizations decline? What steps can top
management take to halt, decline, and restore organizational...
asked 4 hours ago -
What mechanisms Drive speciation??
(I.e. what was Dawins theory on the orgin of species, and how...
asked 5 hours ago -
The manager at a car assembly plant believes that the mean
assembly time for a car...
asked 6 hours ago -
Which of the following is true of electron capture?
A) It decreases the nuclide's mass number...
asked 8 hours ago -
Assuming an efficiency of 43.10%, calculate the actual yield of
magnesium nitrate formed from 114.9 g...
asked 8 hours ago