(15 pts) 4) Determine if the fol answer. Ln(n) Tn (15 pts) 4) Determine if the fol answer. Ln(n) Tn
5. Determine values for N for MN, TN, and SN, so that the corresponding approximations of e dr of the actual value. DO NOT COMPUTE THE APPROXIMATIONS 1.000000 (12 pts) 5. Determine values for N for MN, TN, and SN, so that the corresponding approximations of e dr of the actual value. DO NOT COMPUTE THE APPROXIMATIONS 1.000000 (12 pts)
(2.5 pts) Consider a numerical approximation to s° V1 + x*dx (our methods of integrating don't work for this function, so it is our only option). For each of Ln, Rn, Mn, Tn, and Sn find n so that the approximation is accurate to six decimal places (i.e. off by no more than 10-6) Note: this problem deals strictly with finding the value of K and then choosing n so that the error is small enough. You do not need...
Problem 3. Consider the series: 1 n [ln (n)]4 n=2 a) (6 pts) Use the integral test to show that the above series is convergent. b) (4 pts) How many terms do we need to add to approximate the sum within Error < 0.0004.
both 8. .53 points sCacET6 77.026 Find the approximations Ln, Rn, Tn, and Mn for n = 5, 10, and 20. Then compute the corresponding errors EL, ER, ET, and EM. (Round your answers to six decimal places. You may wish to use the sum command on a computer algebra system.) 10 20 EL ET 10 20 What observations can you make? In particular, what happens to the errors when n is doubled? As n is doubled, EL and ER...
Rank the following functions in terms of asymptotic growth. Please, explain your answer using limits. √n*ln(n) ln(ln(n^2)) 2ln^2(n) n! n0.001 22ln(n) (ln(n))!
Find n such as Tn approximates with a 15 digit precision. What irrational number is approximating?
15. (2 pts) Tn/0 is a cut-and-paste (conservative) transposon. Assume that the target DNA site below is cut by Tn/0 transposase as shown below by arrows 5' GGACTAGGTTTAGCCTCCACT CCTGATCCAAATCGGAGGTGA Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows.
Determine if the series converges absolutely, converges conditionally or diverges summation n=1 infinity (ln n)/n
Write out the first five terms of the sequence with, \(\left[\frac{\ln(n)}{n+1}\right]_{n=1}\), determine whether the sequence converges, and if so find its limit. Enter the following information for \(a_{n}=\frac{\ln (n)}{n+1}\). \(a_{1}=\) \(a_{2}=\) \(a_{3}=\) \(a_{4}=\) \(a_{5}=\) \(\lim_{n \rightarrow \infty} \frac{\ln (n)}{n+1}=\) (Enter DNE if limit Does Not Exist.) Does the sequence converge (Enter "yes" or "no").
(4 pts) The human MN blood type is determined by two codominant alleles, LM and LN The frequency of LM in Eskimos on a small Arctic island is 0.80. 6. a. If random mating takes place in this population, what are the expected frequencies of the M, MN, and N blood types on the island? b. If the inbreeding coefficient for this population is 0.05, what are the expected frequencies of the M, MN, and N blood types on the...