Question

d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was mixed with an unknown primer of length 15 bp, ddC, the four NTPs and DNA polymerase. The resulting mixture of DNA fragments were separated to provide fragments of lengths 23, 24, 28 and 32 bp amongst others (other fragments were observed but are not indicated). Indicate below the sequence of the 15 bp primer from 5 to 3'? WI

the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of lengths 23, 24, 28, and 32 BP amongst others (other fragments were observed but are not indicated). indicate below the sequence of the 15 bo primer from 5' to 3'.

please explain how to do this

Answer 1

Assuming that the given sequence is in 5'-3' direction,

The primer sequence is 5'-TGCGATCGTGTCAGT-3'

ddCTP does not contain 3'-OH group. So, it terminates the chain elongation once it gets incorporated into the growing chain opposite to the G-base in the template strand.

ATTGCTCGACTGGACCTCACTGACACGATCGCA TAACGAGCTGACCTGGAGTGCGATCGTGTCAGT Primer

The chain termination would occur at the C residues (highlighted in red)

The structure of ddATP

High energy phosphate bonds H2N 、、、Base 5 'I O ' Sugar