What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?
Match the words in the left column to the appropriate blanks in the sentences on the right.
1. 32 tRNA is the minimum number of required to translate all 61 sense codons.
Blank number
1. Sixteen
2. Four
3. First and second
4. Third
5. Sixteen
6. Thirty two t RNAs
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match the words in the left column to the appropriate blanks in the sentences on the ri...
What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons? Match the words in the left column to the appropriate blanks in the sentences on the right. second tRNAs with variations each in the positions would sixty one tRNAs suffice to translate sixteen amino acids. Because of wobble in the position, only variations suffice to translate all twenty amino acids. Therefore, sixteen should be the minimum needed to translate...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...