Note that some of these problems refer to information presented in the Tools of Biochemistry 5A-D.
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for.
5′ GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3′
We need at least 10 more requests to produce the solution.
0 / 10 have requested this problem solution
The more requests, the faster the answer.