3-22. Physiological pH is 7 where N terminus stays protonated and c terminus deprotonated. b is correct.
3-23. COO- and NH3+can undergo hydrogen bonding interaction.A.
3-24. 3 nucleotide involved, t-RNA and code amino acids. E is option.
3-25. A. Information is stored in DNA and RNA construct protein using the information. DNA does not construct or store protein.RNA does not break or transport protein.
3-26. Circle is polar which is part B and C. E is answer.
3-27. Carbon II, III, IV and V are chiral as four different substituents are attached.A is answer.
3-25. The function of DNA is to while the function of RNA is to A) store...
Why are nucleotides a good molecule to make DNA out of, while amino acids are good for making proteins? A good answer will include: -how nucleotides compare to amino acids in terms of diversity of shape and feel -how the structure and funciton of DNA compares to the structure and function of proteins -what is the 'job' of DNA? why are the nucleotides good for allowing DNA to carry out its functions? what is the job of a protein? how...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Match what is composed of what 1) RNA is composed of ____ 2) DNA 3) Proteins 4) Triacyglycerol 5)Glycogen 6)Fats 7)Protein 8)Starch a) lipids b) ribonucleotides c) amino acids d) deoxyribonucleotides e) glucose f) nucleotides g) glucose monomers h) protein
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
1. this proteins is responsible for increasing or decreasing supercoiling of DNA A. Helicase B. DNA Polymerase C. Topoisomerase D. RNA Polymerase E. DNA ligase 2. a gene is best defined as A. A segment of DNA that contains inherited information that defines the structure of a protein or RNA B. thee nucleotides that code for an amino acid C. a translated unit of DNA D. a sequence of nucleotides in RNA that codes for a functional product 3. This...
Please give me a complete solutions, don't work on it if you're not going to finished this. This is an old homework, in which I am using to study for the exam. So please don't give me half ass answers. QUESTION 11 If a DNA segment has the sequence GCTAA, what RNA sequence will be made from it? a. CGATT b. CGUTT c. CGAUU d. GCTAA e. UGATT 1 points QUESTION 12 Which of the following brings amino acids...
want to double check!
25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.
The monomer units of proteins, DNA and polysaccharides are, respectively, a. peptides, deoxyribose and fatty acids. b. nucleotides, amino acids, and starches. c. fatty acids, nitrogenous bases and starches. d. amino acids, nucleotides and simple sugars. e. dipeptides, sugars and vitamins.
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...