Why does high stringency ensure that a positive result is the result of the probe binding to its correct target DNA rather than to non-target sequences? (Hint: How does temperature and salt concentration affect the properties of double-stranded DNA and why might this be important for hybridization?)
Why does high stringency ensure that a positive result is the result of the probe binding...
17. Which structure is found in RNA, but would be the result of a mutation or faulty annealing in DNA? A. Hairpin B. Double-stranded helix C. Cruciform D. Sequence complementation E. Bulge 18. A graduate student carefully heated DNA to about 80*C and then prepared it for electron microscopy. She observed a number of small open loops of DNA. What conclusion did she correctly make from her observation? A. The open loops contain DNA mutations, such as cyclobutane dimers and...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Explain the discovery, mechanism of action and function of AID (activation-induced deaminase)? SOMATIC HYPERMUTATION (Figures 7 and 8). Indeed, the discovery of AID provided the missing MSH2-deficient mice had previously been taken to indicate that somatic mutation is initiated by diversification at C:G pairs with MSH2-mediated recognition then triggering a subsequent stage of diversification at A:T pairs. Such a two-stage model was supportedations by the observation that CG-biased mutation was also a characteristic of somatic mutation in B-c nes9 and...
Bakground: Duraweld is a British plastic binding manufacturer established in 1959 and the result of a merger between two local small and medium enterprises (SMEs) in 1970. This company has sailed through the recent economic downturn and has reinvented itself thanks to following lean principles. Duraweld produces customized plastic elements, such as stationery, and decided to move away from standardization to resist the growing competition from Asia on higher volume items resulting in low volume/high variety production profile. Their website...
I need some help with these questions. Please if you not sure of the answer Just leave the questions alone; Am feed up of getting wrong answers. came here for help. Thank you Microbiology. 1. In which of the following scenarios may a bactericidal drug be chosen over a bacteriostatic drug? Your otherwise healthy patient has bacterial conjunctivitis caused by the Gram-negative bacterium Haemophilus aegyptius. Your otherwise healthy patient has pinworm caused by the roundworm Enterobius vermicularis. Your pediatric patient...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
1) Define the following: matter, element, atom, trace element, proton, electron, neutron, atomic number, mass number, isotopes, radioisotope, molecule, compound, salt, ion. 2) List the 6 elements that make up about 99% of the weight of an organism. 3) What are the functions of the trace elements iron, fluorine (fluoride), and iodine? 4) An iodine deficiency can result in goiter. True/False 5) Where are protons, neutrons and electrons located? 6) Can you determine the atomic number and mass number from...
1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....
What are the instruments that have been utilized for the review article discussions? ` 1. Introduction In recent years, nanoclays have been the object of particular interest for many scientists and researchers in chemistry, physics, engineering and biology due to their excellent properties as well as their sustain- ability [1-3]. For instance, they represent the starting point to the de velopment of smart materials for drug delivery (4-9), food packaging [10-12), environmental remediation and wastewater treatment [13], cultural heritage [14–17and...