for the anneal olignucleotides to get double strand DNA from single strand DNA heat the beaker...
for the anneal olignucleotides to get double strand
DNA from single strand DNA heat the beaker and cooling overnight
why? why we do not use the PCR thermocycl?
Homework Answers
For annealing oligonucleotides to get double strand from single strand, it is boiled for breaking unnecessary hydrogen bonds and attachment of primer. After the primer is attached on overnight cooling the remaining nucleotides are added by hydrogen bonds.heating for breaking hydrogen bonds and cooling for forming hydrogen bonds.
In PCR the double stranded DNA is denatured to form single stranded DNA. But DNA in this case is already single stranded. So it is not subjected to PCR since it is a cycle starts with denaturation of double stranded DNA. It is not needed for this case of annealing.
Add Answer to:
for the anneal olignucleotides to get double strand
DNA from single strand DNA heat the beaker...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Below is a single strand of a DNA duplex. Please write down the sequences of the...
Below is a single strand of a DNA duplex. Please write down the sequences of the forward and reverse primers that will anneal to the areas of the duplex represented on this strand in bold? Write these primers down 5'-3' (2 marks Primer 1 Primer 2 5'-ATGGATCGATACGGTAACGATCTCTCTCATGCTTTGGACACGAAAGGCATTCT-3' Primer 1 = Primer 2 = Then estimate the approximate Tm of primer 1 and primer 2 (2 marks). Primer 1 Tm = Primer 2 Tm =
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
DNA replication All choices are correct. duplicates chromosomes uses a single strand of...
DNA replication All choices are correct. duplicates chromosomes uses a single strand of a DNA molecule as a template for the creation of a new double strand. is carried out the DNA polymerase.
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows...
In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows away from the replication fork. mRNA; leading leading; lagging leading; template lagging; template lagging; leading Which of the following is not necessarily related to tumour formation? an overactive MYC gene proto-oncogenes inactive tumour-suppressor genes cell de-differentiation metastasis The total number of unique, three-base combinations of the four nucleic acid bases in DNA is 12. 16. 20. 64. 256. The purpose of cloning is to...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
During DNA replication, because each of the double stranded molecules of DNS consists of a single...
During DNA replication, because each of the double stranded molecules of DNS consists of a single strand of old DNA (parent strand) and a single strand of new DNA (daughter strand), DNA replication is also known as: • A) Origin of replication • B) Replication bubble • C) Semi-conservative replication • D) All of the above
1. The kinetics of the single-step formation of a DNA double strand were measured for the...
1. The kinetics of the single-step formation of a DNA double strand were measured for the reaction: 2 CGGAATTCCG (CGGAATTCCG), a) From the table of experimental data below, calculate AH, AS, and AG for the forward and reverse reactions Temperature (°C) kforward (10 M S ) kreverse (s) 31.8 1.00 36.8 2.3 3.20 41.8 15.4 46.7 87.0 0.8 3.5 6.0 b) Calculate AH, AS, AG, and Keq for the overall reaction at 37 °C. Hint, from the forward and reverse...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Below is a single strand of a DNA duplex. Please write down the sequences of the forward and reverse primers that will anneal to the areas of the duplex represented on this strand in bold? Write these primers down 5'-3' (2 marks Primer 1 Primer 2 5'-ATGGATCGATACGGTAACGATCTCTCTCATGCTTTGGACACGAAAGGCATTCT-3' Primer 1 = Primer 2 = Then estimate the approximate Tm of primer 1 and primer 2 (2 marks). Primer 1 Tm = Primer 2 Tm =
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
1. The kinetics of the single-step formation of a DNA double strand were measured for the reaction: 2 CGGAATTCCG (CGGAATTCCG), a) From the table of experimental data below, calculate AH, AS, and AG for the forward and reverse reactions Temperature (°C) kforward (10 M S ) kreverse (s) 31.8 1.00 36.8 2.3 3.20 41.8 15.4 46.7 87.0 0.8 3.5 6.0 b) Calculate AH, AS, AG, and Keq for the overall reaction at 37 °C. Hint, from the forward and reverse...
20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...
Most questions answered within 3 hours.
-
Aluminum is cast in an insulating ceramic mold with no
superheat. The thickness of the casting...
asked 4 minutes ago -
Discuss the current status of Ulmus americana and the reasons for
it status. (answer in detail...
asked 14 minutes ago -
Q3. A car moves with a constant velocity of 25m/s east with
respect to a person...
asked 19 minutes ago -
If a bond currently sold at $865 with a yield to maturity of 8%
and a...
asked 36 minutes ago -
Q20
You are an international MIS consultant and have been asked to
brief a potential client...
asked 36 minutes ago -
Why companies use the variable costing method when the
absorption costing is the method approved by...
asked 40 minutes ago -
lease solve all the
questions, don't need to explanations
Q1 - All animal
species have general...
asked 5 hours ago -
Business Phasing
1.Discuss the logical progression for growing a business, which
starts from the initial idea...
asked 5 hours ago -
Modify
When executing on the command line having only
this program name, the program will accept...
asked 6 hours ago -
Kenny Electric Company's noncallable bonds were issued several
years ago and now have 20 years to...
asked 7 hours ago -
find H(e^Jtheta) at theta= 0, pi/10, pi/20, pi/2 for
the following:
a) H(e^Jtheta)= 1+e^Jtheta
b) H(e^Jtheta)=...
asked 7 hours ago -
Home Corporation will open a new store on January 1. Based on
experience from its other...
asked 7 hours ago