Question
  1. The following gene sequence has been obtained (only for the first few amino acids).

GGCATAGCAATGACAAATTCAAAAGAAGACGCCGACATAGAGGAGAAGCATATGTACAATGAGCCGGTCACAACCCTCTTTCAC CCGTATCGTTACTGTTTAAGTTTTCTTCTGCGGCTGTATC

You are provided with the following gRNA spacer sequence to target a specific region of this gene:

GAAGCATATGTACAATGAGO

You are also provided with the following repair template sequence to introduce a specific mutation in this sequence through homology-directed repair (HDR):

CCGACATAGAGGAGAAGCATATGTACAACTGAGCCGGTCACAACCCTCTTTCACGA

What is the mutation introduced by this repair template? What are the consequences of this mutation? (2pts)

What would be possible sequences of two forward primers that would be diagnostic for either the introduction of this mutation or the wild-type sequence (no mutation introduced)?

Note: assume that partial and non-specific annealing are not possible


0 0
Add a comment Improve this question Transcribed image text
Answer #1

A new nucleotide C is inserted (insertion mutation) so that a frame shift happens resulting in the formation of stop codon. This causes the protein synthesis to stop at this site and eventually the full protein is not synthesized.

1. If the protein is essential and the full protein is not synthesized then, it may be lethal for the cell to survive

2. If the protein is pharmaceutically important and the full protein is not synthesized, then it may lead to some disease.

Primers for diagnosis

Wild type

5'CATATGTACAATGAGCCGGTC3'

Diseased or mutated

5'CATATGTACAACTGAGCCGGT3'

Add a comment
Know the answer?
Add Answer to:
The following gene sequence has been obtained (only for the first few amino acids). You are...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT