The following gene sequence has been obtained (only for the first few amino acids).
You are provided with the following gRNA spacer sequence to target a specific region of this gene:
You are also provided with the following repair template sequence to introduce a specific mutation in this sequence through homology-directed repair (HDR):
What is the mutation introduced by this repair template? What are the consequences of this mutation? (2pts)
What would be possible sequences of two forward primers that would be diagnostic for either the introduction of this mutation or the wild-type sequence (no mutation introduced)?
Note: assume that partial and non-specific annealing are not possible
A new nucleotide C is inserted (insertion mutation) so that a frame shift happens resulting in the formation of stop codon. This causes the protein synthesis to stop at this site and eventually the full protein is not synthesized.
1. If the protein is essential and the full protein is not synthesized then, it may be lethal for the cell to survive
2. If the protein is pharmaceutically important and the full protein is not synthesized, then it may lead to some disease.
Primers for diagnosis
Wild type
5'CATATGTACAATGAGCCGGTC3'
Diseased or mutated
5'CATATGTACAACTGAGCCGGT3'
The following gene sequence has been obtained (only for the first few amino acids). You are...