Homework Answers
ANSWER :
In the given DNA sequence of chimpanzee there is only one open reading frame (ORF) or coding region present and placed at 5' to 3' direction of DNA strand.
Add Answer to:
A scientist has obtained a sequence of chimpanzee (Pan troglodytes) DNA, which is believed to encode...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
Which amino acids does the below DNA sequence encode for? 5-ATGCCATGG-3 3'-TACGGTACC-5 O Met-Pro-STOP Tyr-Gly-Ser Met-Pro-Trp...
Which amino acids does the below DNA sequence encode for? 5-ATGCCATGG-3 3'-TACGGTACC-5 O Met-Pro-STOP Tyr-Gly-Ser Met-Pro-Trp Tyr-Gly-Thr Met-Pro-Tyr
A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It...
A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with...
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids....
Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...
Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make...
Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make enzymes and hormones which control reactions that must take place in the cell to survive.Proteins are made of basic units called amino acids. There are a total of 20 amino acids. Different proteins have different number and/or combination of amino acids. The kind of amino acid that is used when producing the protein depends on the 3-base code (codon) read from the RNA molecule...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
mRNA transcr leaves the mucl ke protcins Th eings the amino no acids anre the bui ead in onder to. start and stop mak Land when to stot C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop Follow example below Example: DNA AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC UCU GCC...
Which amino acids does the below DNA sequence encode for? 5-ATGCCATGG-3 3'-TACGGTACC-5 O Met-Pro-STOP Tyr-Gly-Ser Met-Pro-Trp Tyr-Gly-Thr Met-Pro-Tyr
A1. The following is the DNA sequence of a hypothetical gene for the SMALL protein. It is called the SMALL gene. i atgggattac actgtcacga ccaaatagcc ttcattgtat 41 caaaaggato aatcgagtta tag Imagine you are doing a research project in a laboratory and your supervisor asks you to clone the SMALL gene into the PBR322 plasmid (shown below). You must use the Pstl and EcoRI sites for your cloning. HindIII EcoRI | EcoRV BamHI 4359 0 29 185 4000 375 Sall Psti...
Roadmap To start, use the provided template file (on Blackboard): project_01_template.py. Replace the pass statements with your code. Notice that we included test cases under every function. If you run the project_01_template.py file at this point it should print False for each test. After you write the correct code for each function, and then run the file, it should print True for each test. 1. Write a function named gc_content that takes one argument sed and performs the following tasks:...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...
Student Sheet Name Title: Making Sentences of DNA structions coded in DNA in this activity yoids. The words Introduction: The instructions coded in DNA must be read and turned into pro molecules for the cell to carry out the instructions. In this activity you will model this process using sentences for DNA and RNA and words for amino acids. The words must line up in the correct order for the protein to form properly, just like words in a sentence...
Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make enzymes and hormones which control reactions that must take place in the cell to survive.Proteins are made of basic units called amino acids. There are a total of 20 amino acids. Different proteins have different number and/or combination of amino acids. The kind of amino acid that is used when producing the protein depends on the 3-base code (codon) read from the RNA molecule...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
Most questions answered within 3 hours.
-
Why did the observed chemistry of thallium mislead Mendelev to
place the group 13 element (Tl)...
asked 31 minutes ago -
A sine wave signal is displayed on the screen of an
oscilloscope. 6 peak-to-peak divisions are...
asked 2 hours ago -
a
1500 kg car accelerates from 0 to 25 m / s in 21.0s. How much...
asked 4 hours ago -
Calculate the molarity of each of the following solutions:
(a) 30.5 g of ethanol (C2H5OH) in...
asked 4 hours ago -
1 Refer to the build-borrow-or-buy framework as a decision tree
for the Adidas company. Identify a...
asked 4 hours ago -
Problem 2: The Problem of Social Cost. A Rancher and Farmer live
side-by-side to each other....
asked 5 hours ago -
a uniform bar of weight 40N is 4 meter long. weights
on 60N and 100N are...
asked 5 hours ago -
Define Diet counceling? What are the
responsibilities of a counselor?
asked 7 hours ago -
Hey im just confused about how to put the ' A angle n' and ' S...
asked 7 hours ago -
A short essay about the WSJ article on Oreo versus Hydrox.
asked 7 hours ago -
##8. A program contains the following function definition:
##def cube(num):
##return num * num * num...
asked 7 hours ago -
find the value z of a standard Normal variable that satisfies
each of the given conditions....
asked 7 hours ago