Consider the protease chymotrypsin. a. What is its normal catalytic activity? b. Can it catalyze the...
Consider the protease chymotrypsin. a. What is its normal catalytic activity? b. Can it catalyze the formation of peptide bonds? Why or why not? c. Does it do so normally in the body? Why or why not?
Homework Answers
Add Answer to:
Consider the protease chymotrypsin. a. What is its normal
catalytic activity? b. Can it catalyze the...
Question 4. Consider the protease chymotrypsin. a. What reaction does it normally catalyze? b. Can it...
Question 4. Consider the protease chymotrypsin. a. What reaction does it normally catalyze? b. Can it catalyze the formation of peptide bonds? Why or why not? c. Where is chymotrypsin active in the body? Can it catalyze formation of peptide bonds in this location? Why or why not?
Please answer section a thru c: 11. Chymotrypsin is a protease, an enzyme that cleaves peptide...
Please answer section a thru c:
11. Chymotrypsin is a protease, an enzyme that cleaves peptide bonds. a) At pH 2, the enthalpy and entropy of denaturation for chymotrypsin are +418 kJ/mol and +1.32 kJ/mol respectively. Calculate the melting temperature for chymotrypsin. b) Chymotrypsin inhibitor (CI) is a small protein that binds to chymotrypsin with high affinity and prevents protease activity. The dissociation constant for Chymo-CI is 110 PM in a salt free solution. What is the Gibbs free energy...
1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words...
1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words (drawings OR both) why serine proteases cleave either before or after different amino acid residues. Talk about at least two of the following proteases: Chymotrypsin, Trypsin, or Elastase. mod 2) (10pts) Below is a hypothetical peptide sequence. Give the peptide fragments that will occur by enzymatic degradation using Trypsin and Chymotrypsin DARSKWKSENLIRTY 3) (10 pts) All superfamilies of serine proteases use the catalytic triad...
Under typical conditions, many essential biochemical reactions proceed so slowly that life could not exist without...
Under typical conditions, many essential biochemical reactions
proceed so slowly that life could not exist without the presence of
enzymes. Enzymes increase reaction rates through a wide variety of
mechanisms. These mechanisms generally utilize the following
strategies: improving the nucleophiles and electrophiles present in
the catalytic R groups or substrates; stabilizing the extra
electron density of the leaving group; and stabilizing transition
states. Proteases are enzymes that break down proteins by
hydrolyzing peptide bonds. Chymotrypsin is a protease found in...
1. Enzymes catalyze reactions by diverse mechanisms, frequently involving multiple steps. Consider the well-studied enzyme called...
1. Enzymes catalyze reactions by diverse mechanisms, frequently involving multiple steps. Consider the well-studied enzyme called chymotrypsin, which has three amino acids in its active site: Asp102, His 57, and Ser 195. What is the catalytic role of His 57? A. covalent catalysis B. general acid-base C. catalysis catalysis by approximation D. metal ion catalysis 2. Which of the following functional groups are not found in carbohydrates? A. aldehydes B. hydroxyls C. ketones D. thiols 3. What are the components...
2. hypothesize the best conditions (pH and temperature) under which the enzyme chymotrypsin functions with an...
2. hypothesize the best conditions (pH and temperature) under
which the enzyme chymotrypsin functions with an appropriate
reference. also, hypothesize what will occur in the presence of an
inhibitor and the type of inhibition.
EXPERIMENT 5: ENZYME ACTIVITY WITH a-CHYMOTRYPSIN Prelab Assignment 1. Prepare a flow chart, covering one half of the experimental work (either part A and C if your lab bench is on the window side of the lab or part B and D if your locker is...
The catalytic reaction A+C D , can be adequately described by the following mechanism: A B...
The catalytic reaction A+C D , can be adequately described by the following mechanism: A B (with ki = forward rate constant, k-1 = backward rate constant) B+C D (with rate constant k) Use the quazi (pseudo) steady state approach to find the rate of formation of D. Consider the following liquid phase catalytic reaction: A+B → C. The reaction has been found to follow the mechanism: A+D AD (very fast) AD +BBAD BAD→D+C (very fast) The rate of reaction...
These can be computed exactly using the normal distribution. Please show all working 6. Consider the...
These can be computed exactly using the normal distribution.
Please show all working
6. Consider the following project network and activity times (in weeks): Start Finish Activity | A BC DEFG H Time 15 376 73 10 8 a. b. c. Identify the critical path. How much time will be needed to complete this project? Can activity D be delayed without delaying the entire project? If so, by how many weeks? d. Can activity C be delayed without delaying the...
Any help would be appreciated! S y of a protease activity of Science you decided to...
Any help would be appreciated!
S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he...
please help! I'm just starting peptides this week, so I'm really lost. Question 1. Consider the...
please help! I'm just starting peptides this week, so I'm really lost. Question 1. Consider the small peptide Pro-Cys-Arg-Gln (a) Draw the entire peptide (careful of peptide bonds!), with charges you would expect on it at pH 7.4. Hint: how many ionizable groups on this peptide? (b) Tabulate the charge on the molecule at every pH between 1 and 13 (c) Calculate the pI for the peptide. What is the overall charge on the peptide at pH 1? pH 7.4?...
Question 4. Consider the protease chymotrypsin. a. What reaction does it normally catalyze? b. Can it catalyze the formation of peptide bonds? Why or why not? c. Where is chymotrypsin active in the body? Can it catalyze formation of peptide bonds in this location? Why or why not?
Please answer section a thru c:
11. Chymotrypsin is a protease, an enzyme that cleaves peptide bonds. a) At pH 2, the enthalpy and entropy of denaturation for chymotrypsin are +418 kJ/mol and +1.32 kJ/mol respectively. Calculate the melting temperature for chymotrypsin. b) Chymotrypsin inhibitor (CI) is a small protein that binds to chymotrypsin with high affinity and prevents protease activity. The dissociation constant for Chymo-CI is 110 PM in a salt free solution. What is the Gibbs free energy...
1) (10 pts) Serine proteases are enzymes that cleave peptide bonds in proteins. Explain using words (drawings OR both) why serine proteases cleave either before or after different amino acid residues. Talk about at least two of the following proteases: Chymotrypsin, Trypsin, or Elastase. mod 2) (10pts) Below is a hypothetical peptide sequence. Give the peptide fragments that will occur by enzymatic degradation using Trypsin and Chymotrypsin DARSKWKSENLIRTY 3) (10 pts) All superfamilies of serine proteases use the catalytic triad...
Under typical conditions, many essential biochemical reactions
proceed so slowly that life could not exist without the presence of
enzymes. Enzymes increase reaction rates through a wide variety of
mechanisms. These mechanisms generally utilize the following
strategies: improving the nucleophiles and electrophiles present in
the catalytic R groups or substrates; stabilizing the extra
electron density of the leaving group; and stabilizing transition
states. Proteases are enzymes that break down proteins by
hydrolyzing peptide bonds. Chymotrypsin is a protease found in...
2. hypothesize the best conditions (pH and temperature) under
which the enzyme chymotrypsin functions with an appropriate
reference. also, hypothesize what will occur in the presence of an
inhibitor and the type of inhibition.
EXPERIMENT 5: ENZYME ACTIVITY WITH a-CHYMOTRYPSIN Prelab Assignment 1. Prepare a flow chart, covering one half of the experimental work (either part A and C if your lab bench is on the window side of the lab or part B and D if your locker is...
The catalytic reaction A+C D , can be adequately described by the following mechanism: A B (with ki = forward rate constant, k-1 = backward rate constant) B+C D (with rate constant k) Use the quazi (pseudo) steady state approach to find the rate of formation of D. Consider the following liquid phase catalytic reaction: A+B → C. The reaction has been found to follow the mechanism: A+D AD (very fast) AD +BBAD BAD→D+C (very fast) The rate of reaction...
These can be computed exactly using the normal distribution.
Please show all working
6. Consider the following project network and activity times (in weeks): Start Finish Activity | A BC DEFG H Time 15 376 73 10 8 a. b. c. Identify the critical path. How much time will be needed to complete this project? Can activity D be delayed without delaying the entire project? If so, by how many weeks? d. Can activity C be delayed without delaying the...
Any help would be appreciated!
S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he...
Most questions answered within 3 hours.
-
Which is a method of transmitting pathogens from one host to
another by carrying microorganisms inside...
asked 3 minutes ago -
Ten young adults living in California rated the taste of a newly
developed sushi pizza topped...
asked 14 minutes ago -
In a titration experiment, 29.9 mL of 0.797 M HCOOH neutralizes
20.6 mL of Ba(OH)2. What...
asked 11 minutes ago -
A
roller coaster cart of mass 312 kg travels around a horizontal
curve of radius 41.3...
asked 24 minutes ago -
M1=7/Hr ==> M2=6/Hr ==> M3=9/Hr ==> M4=8/Hr ==>
Demand = 10/Hr
The diagram shows the hourly...
asked 10 minutes ago -
(Cash Flow Statement) Consider the following potential events
that might have taken place at Global Conglomerate...
asked 16 minutes ago -
What kinds of transitions form the basis for AA and AE?
Can the detector differentiate wavelengths...
asked 24 minutes ago -
Twenty percent of all telephones of a certain type are submitted
for service while under warranty....
asked 24 minutes ago -
If I have a function in python, say show(B), how would I code it
so that...
asked 25 minutes ago -
Size properly the power supply that you need to purchase if you
have the following equipment....
asked 26 minutes ago -
Is voter turnout in Texas a problem? If so how can this issue be
addressed to...
asked 32 minutes ago -
Assume we have these two classes. Note that they are in
separate packages. If the code...
asked 44 minutes ago