Homework Answers
Add Answer to:
4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3". What is the sequence of the...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...
Use the DNA sequence below and the genetic code in your text to answer the following...
Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2....
1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...
The transcribed portion of a DNA sequence for a gene is shown below
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence...
Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5- TTATTCTTTAAT CAT-3 What would be the consequences of the highlighted A to be mutated to a G? Select one: a. The resulting peptide will likely be larger than the non-mutant peptide b. the primary sequence of the peptide will be different on one amino acid O C. The peptide sequence would be the same d. all the amino acids after...
The following sequence is part of the DNA TEMPLATE for a 4 amino acid peptide that starts with Methionine. 5'- TTATTCTTTAAT CAT-3' What would be the consequences of the highlighted A to be mutated to a G? Select one: a. the primary sequence of the peptide will be different on one amino acid b. all the amino acids after the mutation will be different than the non-mutant peptide c. The peptide sequence would be the same d. The resulting peptide...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Use the following figure for Questions 2-3. DNA and DNA template strand I 2. The sequence of the mRNA that would result from transcribing the gene pictured would be A. AUGCGAUUA B. AUUAGCGUA C. UACGCUAAU D. UAAUCGCAU E. ATGCGATTA 3. The sequence of the peptide that would result from transcribing and translating the gene pictured would be A. Tyr-Ala-aso B. Ile-Ser-Val. C. no peptide would be made, the first codon means "stop." D. Met-are-Leu. E. Tyr-Ser-Val.
Most questions answered within 3 hours.
-
Find the magnetic field (in cylindrical coordinates) both inside
and outside of a very long cylindrical...
asked 1 minute ago -
Use the following information to answer the question:
Coupon Rate = 6% Face Value = $1,000...
asked 3 minutes ago -
Let C = (2.25 m, 15 ∘ above the negative x-axis) and D = (30.6
m,...
asked 9 minutes ago -
of the following statements below is/are an example of a
normative statement?
I. The water shortage...
asked 10 minutes ago -
Carbon disulfide is prepared by heating sulfur and charcoal. The
chemical equation is
S2(g)+C(s)−⇀↽−CS2(g) Kc=9.40 at...
asked 14 minutes ago -
complete the problem and solution paragraph below, include 2-3
causes and 2-3 solutions for them.
remember...
asked 16 minutes ago -
I was looking for help with a computer science c programming
class. not c++
This program...
asked 40 minutes ago -
Albinism is an autosomal recessive condition characterized by
absence of melanin pigment from the skin, eye...
asked 30 minutes ago -
Suppose you're looking at a physics example online, and come
across this expression in the middle...
asked 38 minutes ago -
Compile a list (7 or more) of other commands useful for
navigating or manipulating the UNIX/Linux...
asked 48 minutes ago -
How many grams of PbBr2 will precipitate when excess CrBr3
solution is added to 61.0 mL...
asked 50 minutes ago -
If I was given the address of 134.15.0.0/16 from my ISP and I
wanted to use...
asked 55 minutes ago