Question

QUIZ 13 PROTEIN SYNTHESIS 1. The process where mRNA moves so that ribosomes can read each successive codon is referred to as
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. The process of synthesis of protein from mRNA is called translation.

Translocation is the transport of protein from one place to another.

Transposition is jumping of DNA from one position to another.

Transduction is the process of infecting a bacterium with a virus.

Transamination is the transfer of amino group from amino acid to another.

2. Methionine and tryptophan have only one codon.

So, the correct answer is A.

3. Peptide bond is made by peptidyl transferase. These enzymes catalyse the formation of peptide bond.

4. First amino acid is always methionine in eukaryotes.

In prokaryotes first amino acid will be N formyl methionine.

So, the correct answer is D.

5.

The correct answer will be lane 2 as it contains two bands.

So, the correct answer will be 2.

As if digests is there then there will be a band at 300.

Add a comment
Know the answer?
Add Answer to:
QUIZ 13 PROTEIN SYNTHESIS 1. The process where mRNA moves so that ribosomes can read each...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • What role does mRNA play in the process of protein synthesis? Choose all that apply. Select...

    What role does mRNA play in the process of protein synthesis? Choose all that apply. Select one or more: Every three nucleotides binds an amino acid It opens up the DNA strand for transcription to occur ] c. It is a template for the arrangement of tRNAS 1 d. It determines the order in which amino acids are added to the growing protein e. It copies DNA to be used in later steps

  • Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make...

    Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make enzymes and hormones which control reactions that must take place in the cell to survive.Proteins are made of basic units called amino acids. There are a total of 20 amino acids. Different proteins have different number and/or combination of amino acids. The kind of amino acid that is used when producing the protein depends on the 3-base code (codon) read from the RNA molecule...

  • ANSWER THE FOLLOWING QUESTIONS 1) What is the relationship between a gene and a protein? 2)...

    ANSWER THE FOLLOWING QUESTIONS 1) What is the relationship between a gene and a protein? 2) How does the tRNA contribute to protein synthesis? 3) The ability of cell to control their gene expression is called 4) What is a promoter? 5) What process convert the message from mRNA into amino acids? 6) The following expressions are true or false? Explain a. "A gene is any DNA sequence that is transcribed to any type of RNA b. "In eukaryotes, a...

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • Question 2 (1 point) In order to target a protein to the endomembrane system, which of...

    Question 2 (1 point) In order to target a protein to the endomembrane system, which of the following is required first? O a ER bound ribosome signal peptide on the N terminus of the polypeptide chaperone protein signal peptide on the C terminus of the polypeptide O signal-recognition particles A tRNA is chemically modified so that the amino acid bound is different than the one specified by its anticodon. Which codon in the mRNA would the tRNA recognize: the one...

  • Compare Lanes 3 and 4? What question is being asked? How tight of a protein-protein association...

    Compare Lanes 3 and 4? What question is being asked? How tight of a protein-protein association exists? What is the result? Compare lanes 3 and 5? What question is being asked? What is the result? I need help with A and B please and can you explain how you got the answers? Figure 1. Transient Interaction of Newly Synthesized Proteins with Dnak E. coli spheroplasts were pulse-chase labeled at 30°C, followed by lysis and coimmunoprecipitation (co-IP) of Dnak-polypeptide complexes. (A)...

  • 1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion....

    1. Transcription occurs in the a. Nucleus. b. Ribosomes of the Rough Endoplasmic Reticulum. c. Mitochondrion. d. Cell membrane. e. Smooth Endoplasmic Reticulum. 2. The monomers of DNA and RNA are a. amino acids. b. monosaccharides. c. nucleotides. d. fatty acids. e. nucleic acids. 3. Which of the following statements regarding DNA is false? a. DNA uses the nitrogenous base uracil. b. DNA is a nucleic acid. c. One DNA molecule can include four different nucleotides in its structure. d....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT