1.Option b and d is the answer.
Male A with A blood group and Male D with AB blood group.
2.Option d is the answer.
Question 32 Not yet answered Points out of 2.50 P Flag question A female with blood...
n 51 answered A female with blood type O is the mother of a child with blood type A and dies in a tragic accident. Four individuals claim the paternity of the child. Male A is blood type A, male Bis blood type B, Male Cis blood type 0 and Male D is type AB. Based on the blood test only, which individual(s) COULD be the father of the child? Mark all that apply out of 2.50 question Select one...
Question3 Not yet answered Points out of 4.00 P Flag question A person's level of blood glucose and diabetes are closely related. Let r be a random variable measured in milligrams of glucose per deciliter (1/10 of a liter) of blood Suppose that after a 12-hour fast, the random variable x will have a distribution that is approximately normal with mean μ 73 and standard deviation of o 20. What is the probability that, for an adult after a 12-hour...
A female with blood type O is the mother of a child with blood type A and dies in a tragic accident. Four individuals claim the paternity of the child. Male A is blood type A, male B is blood type B, Male C is blood type 0 and Male D is type AB. Based on the blood test only, which individual(s) COULD be the father of the child? Mark all that apply Select one or more: a. None of...
Question 4 Not yet answered Points out of 4.00 Flag question A person's level of blood glucose and diabetes are closely related. Let r be a random variable measured in milligrams of glucose per deciliter (1/10 of a liter) of blood. Suppose that after a 12-hour fast, the random variable x will ave a distribution that is approximately normal with mean 90 standard deviation ofơ-21 What is the probability that, for an adult after a 12-hour fast, x is less...
Question 73 Not yet answered Points out of 1.00 p Flag question Which blood test is reliable and early indication of cardiac damage, indicative of an acute myocardial infarction? Select one: o a. Creatinine kinase (CK) O b. Complete blood count (CBC) O c.Troponin 1 O d. Lactate dehydrogenase (LD) Question 74 Not yet answered Points out of 1.00 p Flag question The nurse observes that an older client has a hunched back and measures 1-inch shorter than last year....
Question 29 Not yet answered Marked out of 1.00 P Flag question What is the role of substrate-level phosphorylation in glycolysis? Select one: a. a process to synthesize oxygen (02) b. a process to do all of the above (a, b and c) c. a process to synthesize glucose d. a process used to synthesize ATP Question 35 Not yet answered Marked out of 1.00 P Flag question Plants use_to transport sucrose to all regions of the organism. Select one:...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Question 10 Not yet answered Marked out of 1.00 P Flag question The role of inflammation in the development of atherosclerosis includes: Select one: O a. damage to the cells lining the arteries by factors such as high HDL cholesterol O b. white blood cells being send to the site by the immune system to try to repair the damage O c. production of foam cells that help to capture and remove LDL from the artery wall O d. proliferation...
Question 6 Not yet answered Marked out of 1.00 P Flag question Chemiosmosis ... Select one: O a. refers to harnessing the energy generated by the proton-motive force O b. Occurs primarily during glycolysis O c. is a form of substrate-level phosphorylation O d. Refers to the transfer of glucose across the mitochondrial membrane. Question 7 Not yet answered Marked out of 1.00 Flag question space) (space) (membrane) (mer In this image, where would you expect to see ubiquinone? Select...
Question 10 Not yet answered Marked out of 3.00 P Flag question Which of the following is part of the non-specific, innate & general immunity? Choose all that apply. Select one or more: a. Fever b. Antibodies c. Inflammation d. B Lymphocytes e. Plasma Cells f. T Lymphocytes g. Skin h. Phagocytes