Question

Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c. Both strands can be templates. Two peptides can be formed, one with 8 and one with 9 amino acids d. The template is the bottom strand. The peptide formed will have 9 amino acids O e. The template is the top strand. The peptide form will have 8 amino acids

Answer 1

55. Answer: Option D is correct
Explanation:
The top strand = Coding strand
The bottom strand = Template strand
Coding sequence: 5'-ATGCCCAGCCGAATTGTAATCCAATTGA-3'
Amino acid sequence: MPSRIVIQL
Number of amino acids = 9

56. Answer: Option A is correct
Explanation:
Primary immunofluorescence utilizes a single antibody that is directly conjugated to the fluorophore.