Homework Answers
1. All options are correct.
The backbone of human DNA is formed by sugar and phosphate linked by phosphodiester bonds.
The two strands of DNA are anti parallel and complementary to each other so they form a double stranded helix. If one strand is 5' - 3', the other strand will be 3' - 5'
The alpha helix is formed by hydrogen bonds between the hydrogen of amine group and oxygen of carboxyl group and results in a twisted right handed DNA helix.
DNA molecule has constant diameter because pyrimidine eg. Cytosine forms triple bond with purine eg. Guanine and interrelationship between purine and pyrimidine maintains the constant diameter.
Add Answer to:
17 Which of the following statements is not TRUE with respect to the structure of DNA?...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids ะพ b. The template is the top strand. The peptide form will have 9 amino acids O c....
You've identified a gene likely involved in a human disease.
Question 3You've identified a gene likely involved in a human disease. You BLAST the predicted protein sequence for the gene against the database of known protein sequences and see that a domain of your unknown protein is similar to the nuclease domain of a RISC complex protein. Therefore... Select one: a. The unknown gene is likely to be a microRNA gene b. The unknown protein is likely to be a nuclease that cuts RNA c. The unknown protein is likely to be a nuclease...
Each of the following statements about the structure of DNA may be either true or false....
Each of the following statements about the structure of DNA may be either true or false. Choose the appropriate answer for each of these statements. Bonding between adenine and thymine on opposite strands involves two hydrogen bonds. Nitrogenous bases are located on the outside of the double helix: phosphates are located towards the middle of the double helix. Bonding between guanine and cytosine on opposite strands involves three hydrogen bonds. DNA and RNA are structurally different due to the difference...
How DNA Is Copied 4. What does it mean that the two strands of DNA are...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
Part B Which of the following statements about DNA structure is true? View Available Hint(s) The...
Part B Which of the following statements about DNA structure is true? View Available Hint(s) The pentose sugar in DNA is ribose. O ooo Hydrogen bonds formed between the sugar.phosphate backbones of the two DNA chains help to stabilize DNA structure Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Submit Part What is the complementary DNA sequence...
14.7 A number of antiviral drugs act by preventing viral DNA synthesis. These drugs are typically...
14.7 A number of antiviral drugs act by preventing viral DNA synthesis. These drugs are typically chemically similar to nucleotides with a modification. For example, the drug may contain all relevant components of a nucleotide, including a proper purine or pyrimidine base, but lack the 3' OH group. How would this modification allow this drug to prevent viral DNA synthesis? A. Once inserted into a growing DNA chain, the drug will not be able to form a normal double-helix, as...
Question 14: The answers on 14 and 9 are incorrect. Answer the question 14 and question...
Question 14:
The answers on 14 and 9 are incorrect.
Answer the question 14 and question 9 plz, thanks a lot.
Helicase strand Refer to the above diagrams and match the components of the replisome with the description of their function A Extends an Okazaki fragment Single-stranded binding Holds DNA polymerase in place proteins (SSBPs) during strand extension H Topoisomerase Catalyzes the breaking of hydrogen bonds between base pairs to open Primase - leading strand the double helix D. Catalyzes...
In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
QUESTION 10 If an enzyme degraded linker DNA, what would be an immediate consequence? O A....
QUESTION 10 If an enzyme degraded linker DNA, what would be an immediate consequence? O A. DNA helix would be unable to form O B. nucleosomes would be unable to form a chromatin fiber OC. chromatin fibers would not condense O D.nucleosomes would be unable to form QUESTION 11 This characteristic of DNA allows the molecule to be a template which specifies the sequence of nucleotides in the opposite strand O A. The backbone is phosphate and sugars O B....
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points ...
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids ะพ b. The template is the top strand. The peptide form will have 9 amino acids O c....
Each of the following statements about the structure of DNA may be either true or false. Choose the appropriate answer for each of these statements. Bonding between adenine and thymine on opposite strands involves two hydrogen bonds. Nitrogenous bases are located on the outside of the double helix: phosphates are located towards the middle of the double helix. Bonding between guanine and cytosine on opposite strands involves three hydrogen bonds. DNA and RNA are structurally different due to the difference...
How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...
Part B Which of the following statements about DNA structure is true? View Available Hint(s) The pentose sugar in DNA is ribose. O ooo Hydrogen bonds formed between the sugar.phosphate backbones of the two DNA chains help to stabilize DNA structure Nucleic acids are formed through phosphodiester bonds that link nucleosides together. The nucleic acid strands in a DNA molecule are oriented antiparallel to each other, meaning they run in opposite directions. Submit Part What is the complementary DNA sequence...
Question 14:
The answers on 14 and 9 are incorrect.
Answer the question 14 and question 9 plz, thanks a lot.
Helicase strand Refer to the above diagrams and match the components of the replisome with the description of their function A Extends an Okazaki fragment Single-stranded binding Holds DNA polymerase in place proteins (SSBPs) during strand extension H Topoisomerase Catalyzes the breaking of hydrogen bonds between base pairs to open Primase - leading strand the double helix D. Catalyzes...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
QUESTION 10 If an enzyme degraded linker DNA, what would be an immediate consequence? O A. DNA helix would be unable to form O B. nucleosomes would be unable to form a chromatin fiber OC. chromatin fibers would not condense O D.nucleosomes would be unable to form QUESTION 11 This characteristic of DNA allows the molecule to be a template which specifies the sequence of nucleotides in the opposite strand O A. The backbone is phosphate and sugars O B....
Most questions answered within 3 hours.
-
The pH of a sample of water from a river is 5.0. A
sample of effluent from...
asked 5 minutes ago -
At the beginning of the period, the Fabricating Department
budgeted direct labor of $136,500 and equipment...
asked 32 minutes ago -
Please answer all
____ 28. Rent control is usually
justified on the grounds that it protects...
asked 32 minutes ago -
PARTS A-D HAVE BEEN ANSWERED. WAS TOLD TO REPOST. ONLY ANSWER
PARTS E and F.
A...
asked 49 minutes ago -
2) You are given the task of finding a representation for a
circle in a drawing...
asked 1 hour ago -
STUDY QUESTION: Does use of diet drug fen-phen
(fenfluramine-phentermine) cause valvular heart disease?
HINT: Valvular heart...
asked 1 hour ago -
1. An object weighing 40 N rests on a surface. The coefficient
of friction is 0.35....
asked 3 hours ago -
Investor company owns 35% of investee company voting stock and
accounts for the investment under the...
asked 4 hours ago -
The number of major faults on a randomly chosen 1 km stretch of
highway has a...
asked 4 hours ago -
Consider the competitive environment of Starbuck's, Progressive
Insurance, a manufacturing firm with low turnover, or a...
asked 5 hours ago -
3. Gains from trade
Consider two neighbouring island countries called Euphoria and
Contente. They each have...
asked 7 hours ago -
A business executive has the option to invest money in two
plans: Plan A guarantees that...
asked 9 hours ago