5) DNA is negatively charged, histone proteins are rich in positively charged amino acids arginine and lysine, so histone proteins are positively charged.
Nucleosome is the DNA wrapped around histone octamer.
so the answer is e) DNA is negatively charged and nucleosomal histones are positively charged.
7) Ab/aB is crossed with ab/ab ( test cross)
the parental type gametes produced by Ab/aB are Ab and aB, recombinant type gametes are AB and ab.
Ab/aB *ab/ab
AB | Ab | aB | ab | |
ab | AB/ab | Ab/ab | aB/ab | ab/ab |
recombinant progenies are formed from the recombinant gametes, ab is recombinant gamete, so ab/ab progeny is recombinant progeny.
recombination frequency is the percentage of recombinant progenies.
recombination frequency= (number of recombinant progenies/total number)100
distance between genes is 32 map units, so recombination frequency between genes is 32%.
recombination frequency in percentage is the distance between genes in map units.
so here percentage of ab/ab progeny + percentage of AB/ab progeny=32%
percentage of ab/ab progeny = percentage of AB/ab progeny=32/2=16%
( both recombinant progenies are expected in equal proportion)
expected number of ab/ab progenies among 100 progenies= 10016/100=16
so the answer is 16
DNA has a strong attraction to nucleosomes because: Question 5 Not yet answered Points out of...
Question 3 Not yet answered Marked out of 3.00 P Flag question How can chloride attack the positively charged carbocation (left), which is surrounded by sterically bulky methyl and ethyl groups? 10 + CH fast Select one or more: O a. The carbocation is now pyramidal, so the carbon is open to attack o b. The elactrostatic attraction between the positively-charged carbon and negatively charged chloride overcome steric considerations c. The positive charge on the carbon pushes the methyl and...
Question 48 Not yet answered Marked out of 1.00 Flag question Which phenotype would not be possible in an offspring whose parents had AB blood? Select one: o a. type A ob. tуре в о с. type AB d. type o
Question 12 Not yet answered Points out of 1.00 P Flag question The DNA remains in the nucleus when RNA is made. That process is properly known as Select one: O a. transcription. O b. translation. c. transmutation. d. conversation. Question 13 Not yet answered Points out of 1.00 P Flag question The copy of the DNA in the form of RNA leaves the nucleus and goes to the Select one: a. cell membrane. b. Golgi bodies C. vacuole. Od....
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
Question 11 Not yet answered Marked out of 1.00 P Flag question The DNA of an organism is studied and found to contain 14% guanine. This organism should have __% thymine and __% cytosine in its DNA. Select one: O a. 36; 36 O b. 14; 36 O c. 14; 86 O d. 36; 14 Question 12 Not yet answered Marked out of 1.00 Flag question The strands of a DNA double helix are said to be antiparallel. This means...
I need final answer for this question QUESTION 2 Not yet answered Marked out of 1.00 P Flag question X and Y are two uncharged metal spheres on insulating stands and are in contact with each other. A positively charged rod Ris brought close to X as shown in Figure (a). Sphere Y is now moved away from X as in Figure (b). At the end of this experiment, X and Y HHHH X Y R R Figure (a) Figure...
Question 12 Not yet answered Marked out of 1.00 Remove flag The epigenome on the DNA strand: Select one: O a. regulates the expression of genes by turning them on or off O b. makes the gene expression more permanent and difficult to change O c. changes the DNA for different functions O d. is active for only one generation
Question 1 Not yet answered Consider the following western blot for tubulin. Each lane represents a different cell line culture. What can be concluded from this blot? Points out of 2.50 P Flag question 191 97 64- 51 -B-Tubulin 39 28 19- Select one: a. Tubulins from different organisms vary in size O b. More than one statement can be concluded from this western blot c. Tubulin is expressed in all cell lines tested O d. The primary antibody used...
Question 15 Not yet answered Which of the following is TRUE about eukaryotic enhancers: An enhancer Points out of 2.50 P Flag question Select one: O a. Is a DNA sequence that can be far away from the promoter and where transcriptional activators bind O b. Is an operator DNA sequence where the Mediator complex binds o c. Is a DNA sequence where the general transcription factors bind O d. Is a protein that binds at the promoter and activates...
Question 16 Not yet answered Points out of4.00 P Flag question If the probability that an event will happen is 0.27, what is the probability that the event won't happen? Select one: O a.0.83 O b.0.23 О С. 063 o d. 0.73 O e. 1.73 Time left 0:12:44 Type here to search PrtSen rs