Refer to the figure showing the use of transposons as mutagens in Mycoplasma genitalium.
Which statement is true?
| a. |
Gene A is essential, because there was growth when gene A was mutagenized. |
|
| b. |
Whether gene A is essential or not depends on gene B. |
|
| c. |
Gene A is essential, because there was no growth when gene A was mutagenized. |
|
| d. |
Gene A is not essential, because there was growth when gene A was mutagenized. |
|
| e. |
Gene A is not essential, because there was no growth when gene A was mutagenized. |
Homework Answers
Option d is the answer.
Because there is growth when A is mutated.So,B is enough to allow bacterial growth.
Add Answer to:
Refer to the figure showing the use of transposons as mutagens
in Mycoplasma genitalium.
Which statement...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
Yet, all the cells in your body contain the same genes (and same alleles). The difference...
Yet, all the cells in your body contain the same
genes (and same alleles). The difference across cell types
is that genes get selectively expressed (turned on or off)
based on the proteins needed for cellular function given their
environment.
Select which statement explains the reason why hair does not
normally grow on your muscle cells.
a.
Muscle cells have the gene for keratin, but do not express
it
b.
Muscle cells do not have the gene for keratin and...
25. What is a riboswitch? A. a small molecule that regulates the translation of specific mRNAs...
25. What is a riboswitch? A. a small molecule that regulates the translation of specific mRNAs B. a gene regulatory protein that turns on the expression of ribosomal proteins C. an mRNA that can regulate its own transcription and translation D. a ribosome that participates in attenuation E. when the antisense RNA binds to the transcript 26. In the Ames Test, the appearance of his+ revertants in the presence of a non-mutagenic control compound indicates that _______. A. liver extract...
Which of the following statements about Huntington's is true? You can retry this question, the average...
Which of the following statements about Huntington's is true? You can retry this question, the average of your two answers is recorded. You should see feedback if you get a question wrong. O a. The mutated allele(s) has/have lost the function of keeping brain cells healthy, and is/are therefor a dominant disease O b. Huntington is a very rare and therfor recessive. c. Huntington strikes people after reproductive age and is therefor dominant. d. The mutated allele(s) has/have gained the...
Use the figure above to answer the following question. Which of the dotted lines on the...
Use the figure above to answer the following
question. Which of the dotted lines on the graph above
shows logistic growth of a population in which the per capita rate
of growth AND the carrying capacity are MORE than that of the curve
for the population shown by the black line?.
a, b,c,d
- А D #individuals Time
Price S2 S1 Quantity Refer to Figure 3-8. The graph in this figure illustrates an initial...
Price S2 S1 Quantity Refer to Figure 3-8. The graph in this figure illustrates an initial competitive equilibrium in the market for motorcycles at the intersection of D1 and 52 (point B). Assume that Motorcycles are a normal good. If there is an increase in number of companies producing motorcycles and a decrease in income (assume motorcycles are a normal good), the equilibrium could move to which point? ΟΑ) Α ОВ) в 0 O C) c OD E Panel (a)...
Which of the following is not a true statement? Question 10 options: a) The Central Limit...
Which of the following is not a true statement? Question 10 options: a) The Central Limit Theorem will work for skewed data, but the more skewed the data, the more data needed. b) When working with proportions, we do not need to worry about whether or not our successes/failures are greater than 10. c) The Central Limit Theorem depends upon independent observations. d) The center of the sampling model will be the true mean of the population from which we...
Supply 29. Refer to Figure 6. When the price rises from PI to P2, which area...
Supply 29. Refer to Figure 6. When the price rises from PI to P2, which area represents the increase in producer surplus to existing producers? a. BCG b. ACH c. DGH d. ABGD 30. Refer to Figure 6. Which area represents the increase in producer surplus when the price rises from P1 to P2 due to new producers entering the market? a. BCG b. ACH c. DGH d. AHGB Figure 7 Focus ed States) E E
REFER TO THE FIGURE BELOW Which statement below is false? 10 9 8 7 6 B...
REFER TO THE FIGURE BELOW Which statement below is false? 10 9 8 7 6 B Y 4 A O 5 10 E The curve shown above is for one specific flow rate Point E represents the supercritical depth None of these answers are false Point A is the only point in which you truly have hydraulic control Point F represents the supercritical depth
Problems 12 and 13 refer to the following Figure which shows the sy A B A...
Problems 12 and 13 refer to the following Figure which shows the sy A B A B Problems 7 and 12. Decide whether each of these statements is True (T) or False (F). The valve has (1) 4 ports (ii) 2 positions A () T (ii) T B O T (ii)IF C (O) F (ii) T D O) F (ii) F 13. Decide whether each of these statements is True (CT) or False (F), In the control positions: (i) A...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
Yet, all the cells in your body contain the same
genes (and same alleles). The difference across cell types
is that genes get selectively expressed (turned on or off)
based on the proteins needed for cellular function given their
environment.
Select which statement explains the reason why hair does not
normally grow on your muscle cells.
a.
Muscle cells have the gene for keratin, but do not express
it
b.
Muscle cells do not have the gene for keratin and...
Which of the following statements about Huntington's is true? You can retry this question, the average of your two answers is recorded. You should see feedback if you get a question wrong. O a. The mutated allele(s) has/have lost the function of keeping brain cells healthy, and is/are therefor a dominant disease O b. Huntington is a very rare and therfor recessive. c. Huntington strikes people after reproductive age and is therefor dominant. d. The mutated allele(s) has/have gained the...
Use the figure above to answer the following
question. Which of the dotted lines on the graph above
shows logistic growth of a population in which the per capita rate
of growth AND the carrying capacity are MORE than that of the curve
for the population shown by the black line?.
a, b,c,d
- А D #individuals Time
Price S2 S1 Quantity Refer to Figure 3-8. The graph in this figure illustrates an initial competitive equilibrium in the market for motorcycles at the intersection of D1 and 52 (point B). Assume that Motorcycles are a normal good. If there is an increase in number of companies producing motorcycles and a decrease in income (assume motorcycles are a normal good), the equilibrium could move to which point? ΟΑ) Α ОВ) в 0 O C) c OD E Panel (a)...
Supply 29. Refer to Figure 6. When the price rises from PI to P2, which area represents the increase in producer surplus to existing producers? a. BCG b. ACH c. DGH d. ABGD 30. Refer to Figure 6. Which area represents the increase in producer surplus when the price rises from P1 to P2 due to new producers entering the market? a. BCG b. ACH c. DGH d. AHGB Figure 7 Focus ed States) E E
REFER TO THE FIGURE BELOW Which statement below is false? 10 9 8 7 6 B Y 4 A O 5 10 E The curve shown above is for one specific flow rate Point E represents the supercritical depth None of these answers are false Point A is the only point in which you truly have hydraulic control Point F represents the supercritical depth
Problems 12 and 13 refer to the following Figure which shows the sy A B A B Problems 7 and 12. Decide whether each of these statements is True (T) or False (F). The valve has (1) 4 ports (ii) 2 positions A () T (ii) T B O T (ii)IF C (O) F (ii) T D O) F (ii) F 13. Decide whether each of these statements is True (CT) or False (F), In the control positions: (i) A...
Most questions answered within 3 hours.
-
A fair -sided die is rolled four times. What is the probability
that all four rolls...
asked 1 minute ago -
True or false: The Pearson's correlation coefficient of +0.4
shows a stronger linear association than a...
asked 4 minutes ago -
A long, nonconducting, solid cylinder of radius 5.5 cm has a
nonuniform volume charge density ρ...
asked 8 minutes ago -
what is the molarity of an HCL solution 28.6ml of a
.175 m NaOH solution is...
asked 10 minutes ago -
Which of the following is true in long-run equilibrium
for both perfect competition and monopolistic competition?...
asked 14 minutes ago -
A
c-chart
is based on the
A.
Poisson distribution.
B.
binomial distribution.
C.
normal distribution.
D....
asked 19 minutes ago -
Composite score on the ACT and the SAT are normally distributed.
Mary scored 26 on the...
asked 24 minutes ago -
2) A board with a mass of 9 kg, which is 4 meters long, rests on...
asked 24 minutes ago -
continuous board that's located along the top edge of the roof
where the rafters connect is...
asked 24 minutes ago -
In a reaction 1 test tube has CaCl2 mixed with H2C2O4, HCl and
NH3. After adding...
asked 25 minutes ago -
The nanograms per microliter of a drug still presents n a
patient's bloodstream 1 hour after...
asked 52 minutes ago -
For the first ten questions, you'll use the following data. It
will be repeated for your...
asked 45 minutes ago