Question

The genes O, S, and U occur in that order in a newly discovered species of nematode. After performing series of genetic crosses, you find that is 23 map units from S, and S is 17 map units from U. Whát is th expected frequency of double crossovers during meiosis? 3.9% 5% 35% 0.39% O 39% Question 24 3 pts the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be +1 S AGCTOGGCGCGCTTCGGTCGTCGTGATGCGCTATATAGTCTGGCGAAGCTACCGACGTAATGGCTGATGTACGT-3' CUU LAU AUG AAG

Answer 1

1) The double cross over always shows a lower frequency. The percentage of crossing over is directly proportional to the distance between the genes.

Given,

• Distance between O and S is 23map units.
• The distance between S and U is 17map units.

Morgan said that

1%RF = 1cM = 1map unit

It means the recombination frequency between S and O is 23 % = 0.23

The recombination frequency between S and U is 17% = 0.17

The frequency of double cross will be 0.23 * 0.17 = 0.0391

Frequency of double cross (%) = 3.91%

2) The first codon is always AUG there are some non-AUG codons also but they are rare like GUG, UUG etc.