Question 24:
Which of the following statements is true about transcription?
Group of answer choices
a. In both prokaryotic and eukaryotic cells, transcription requires a promoter
b. In eukaryotic cells, orientation and positioning of the polymerase is determined by sigma
c. All transcription initiates in the cytoplasm
d. In prokaryotic cells, orientation and positioning of the polymerase is determined by TBP and TFII-like transcription factors
Question 25:
If the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be:
Group of answer choices
a. AUG
b. UAU
c. CUU
d. AAG
Question
24. The true statement about transcriptions are:
In both prokaryote and eukaryotic cell, the two different type of organism require promoter for the transcription. It is the region where RNA polymerase bind and start the transcription.
Hence option a is correct.
25. The methionine is the first amino acid which would be translated and have AUG codon. Hence option a is correct.
Question 24: Which of the following statements is true about transcription? Group of answer choices a....
please answer all 4 questions Question 23 3 pts A plant that is homozygous recessive for mangled leaf and prickly fruit (mmpp) is crossed with the double heterozygote (MmPp), resulting in 1047 offspring: 472 with mangled leaves (mP), 453 with prickly fruit (Mp), 63 wild type (MP), and 59 with mangled leaves and prickly fruit (mp). From these data, you can conclude that o The M and P genes are located 11.7 CM apart o The M and P genes...
Question 24 U If the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be: +1 S'AGCTGGGCGCGCTTCGGTCGTCGTGATGCGCTATATAGTCTGGCGAAGCTACCGACGTAATGGCTGATGTACGT-3' CUU UAU AUG AAG
What is the function of the TATA binding protein (TBP)? Group of answer choices aids in the removal of introns from eukaryotic pre-mRNA allows prokaryotic RNA polymerase to bind to the promoter of genes allows eukaryotic RNA polymerase II to bind to the promoter of genes helps termination factors bind and terminate transcription. All of the answer options are correct.
The genes O, S, and U occur in that order in a newly discovered species of nematode. After performing series of genetic crosses, you find that is 23 map units from S, and S is 17 map units from U. Whát is th expected frequency of double crossovers during meiosis? 3.9% 5% 35% 0.39% O 39% Question 24 3 pts the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would...
1. How is the start codon identified in prokaryotic cells? a. It is the only AUG on the mRNA strand. b. It is the AUG after the Shine-Dalgarno sequence. c. It is the AUG right next to the promoter on the mRNA. d. It is the AUG after the Kozak sequence. e. It is the AUG nearest the 5' end of the mRNA. 2. All of the following are true for eukaryotic transcription EXCEPT: a. Transcription can be terminated when...
- Part Which of the following statements about eukaryotic transcription is false? View Available Hint(s) Transcription initiation occurs when RNA polymerase binds to a complex of transcription factors at the TATA box Submit о Eukaryotic promoter regions contain a TATA box and a CAAT box A polycistronic mRNA may be transcribed if the gene products are used in the same pathway or needed at the same time. 04 The transcripts produced contain both exons and introns Submit
A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The intron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly-A tails are added following the sequence AGUUGG. The poly-A tails are 20 nucleotides. b. If this is an oncogene that is elevated in cancer cells, design two siRNAs to knock down the mRNA, list the sequences of the siRNAs...
QUESTION 4 Which of the following is NOT a mechanisms of protein expression? Specific transcription factors binding to enhancers Export of mRNA into the cytoplasm DNA polymerase phosphorylation 5'UTR secondary structure blocking AUG QUESTION 5 Suppose you have all the necessary proteins for transcription of a gene present AND active/turned on AND in the right location within the cell. Under what conditions would you NOT see transcription of that gene? UmRNA has already been transcribed from that gene but has...
Question 14 Which of the following is a feature common to BOTH prokaryotes and eukaryotes? The use of nucleosomes to condense DNA in the nucleus. The ability to translate an RNA before its transcription is complete. The ability to have multiple ribosomes on a single RNA for more efficient translation. The ability to start transcription at a 5'AUG sequence. o Question 15 A particular prokaryotic promoter contains only the region from-10 to-35. Which of the following is true? The RNA...
A promotor is used by RNA polymerase during which stage of transcription? Group of answer choices A. Initiation B. Elongation C. Termination D. Promotion 2. In eukaryotic cells, mRNA is modified in several ways. Match the mRNA modifications to their functions. Group of answer choices [ Choose ] Portions of the mRNA that are removed before translation. Helps ribosomes attach to the mRNA. Depending on the length, this structure can help...