Question

please answer all 4 questions

Question 23 3 pts A plant that is homozygous recessive for mangled leaf and prickly fruit (mmpp) is crossed with the double heterozygote (MmPp), resulting in 1047 offspring: 472 with mangled leaves (mP), 453 with prickly fruit (Mp), 63 wild type (MP), and 59 with mangled leaves and prickly fruit (mp). From these data, you can conclude that o The M and P genes are located 11.7 CM apart o The M and P genes are located at least 50 CM apart o The M and P genes sort independently o The M and P genes are located 6 CM apart Question 24 3 pts Which of the following statements is true about transcription? o In prokaryotic cells, orientation apd positioning of the polymerase is determined by TBP and TFi-like transcription factors o In both prokaryotic and eukaryotic cells, transcription requires a promoter In eukaryotic cells, orientation and positioning of the polymerase is determined by sigma o All transcription initiates in the cytoplasm Question 25 3 pts When we say that the genetic code is unambiguous, we mean that: of several codons specify the same amino acid, the first two bases are usually identical o Codons are read one at a time . One codon never codes for more than one amino acid o All but two amino acids are encoded by more than one codon Question 26 3 pts If the transcribed mRNA using this coding strand were to be translated, the first codon converted into an amino acid would be: +1 S'AGCTGGGCGCGCTTCGGTCGTCGTGATGCGCTATATAGTCTGGCGAAGCTACCGACGTAATGGCTGATGTACGT-3" O AAG o CUU o UAU o AUG

Answer 1

Ans23)the M and P genes sort independently.

Explaination:

Cross:MmPpx mmpp

Progeny:

Mangled leaves (mP)=472(recombinant)

Prickly fruit(Mp)=453(recombinant)

Wild type(MP)=63 (parental)

Mangled leaves and prickly fruit(mp)=59 (parental)

Recombinant frequency between M and P gene=No of recombinant /total population =472+453/1047=0.88

Recombinant distance between M and P gene=0.88x100=88 cM

Maximum Recombinant distance that can occur between two genes is 50cM.

There recombinant distancebetween  M and P genes illustrate that these two genes are unlinked gene present on same chromosome or on separate chromosomes and they independently assort from each other during gamete formation.

Ans24)In both prokaryotic and eukaryotic cells, transcription requires a promoter.

Explaination: in prokaryotic cells , alpha subunit play role in assembly of core enzyme(RNA polymerase core) and recognition of promoter region. And sigma subunit helps in promoter recognization and transcription initiation.

In eukaryotic cell , the orientation and Positioning of the RNA polymerase is determined by bhai the transcription factor II and TBP.

Both prokaryotic and Eukaryotic cell transcription requires promoter which are DNA sequences present at the template DNA strand and they are the site at which RNA polymerase binds and initiate the the transcription.

All transcription initiates in nucleus.

Ans25)one codon never codes for more than one amino acid

Explaination:Genetic code is unambiguous means one codon code only one type of amino acid. It will never code for more than one type of amino acid.

Ans26)AUG

Explaiantion:Start codon is always AUG which code for methionine .

(Coding DNA) open reading frame :-5'ATGGCTGATGTACGT3'

mRNA codon sequences. :- 5'AUGGCUGAUGUACGU3'