You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

Question

Question

You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary w

Human: CTATAATGCCACTCCTGTAATTAGATAAGGAAGTAGGTCTC To test the hypothesis that the three conserved regions function as regulato

Construct 8 ... absent absent What can you conclude from these results? Fill in the appropriate blanks with the following cho

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

1) a)4 b)3 - Region 1 is necessary but not sufficient; region 3 is needed.

2) c)5 -Region 2 is necesary and sufficient

3) e)4 ,1 -Region 3 is necessary but not sufficient; region 1 is needed.

Add a comment

Answer 2

Similar Homework Help Questions

You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....
You decide to make a construct that places the DNA between the genes upstream to a...

You decide to make a construct that places the DNA between the genes upstream to a reporter gene (GFP) in place of Gene 1. The full-length construct has the correct expression pattern in antennal discs. You then create several constructs that delete sections of the upstream DNA and score them for expression. The seven constructs are shown below; the black bars indicate the region(s) deleted in each construct. The data table on the right shows the expression results for each...
During Drosophila development, adult structures are formed from clusters of cells called imaginal discs, which are...

During Drosophila development, adult structures are formed from clusters of cells called imaginal discs, which are recognizable during larval and pupal stages. You are interested in the genes expressed in imaginal discs, and you have identified two such genes that are closely linked together. • Gene 1 is expressed in the imaginal discs that will become the adult antennae. • Gene 2 is expressed in the discs that will become the adult wings and legs. A map of the two...

You are conducting an experiment identifying enhancers that regulate the expression of a gene that codifies...

You are conducting an experiment identifying enhancers that regulate the expression of a gene that codifies for a protein that participates in cell division. The gene is called Mitosis Regulatory Protein A or MRPA. The complete DNA sequences for the MRPA promoter and coding region have been identified. However, it is unknown if MRPA has enhancers regulating its transcription. To answer this question your lab first produced a transgenic cell line where GFP has been inserted as a reporter gene....
1. Gene B is usually expressed only in skin cells. To learn about the mechanism by...

1. Gene B is usually expressed only in skin cells. To learn about the mechanism by which expression of the gene B is regulated, you make clones that contain a GFP reporter and various parts of the upstream and downstream intergenic regions of genomic DNA that normally surround gene B (black lines) as shown in the figure below. The resulting clones were introduced into frog skin cells growing in the lab and levels of GFP expression was monitored by measuring...
molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory r...

molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory region of a muscle-specific cDNA gene (gene M) that you have previously identified. 6 (a) For your study, you need to isolate a genomic clone of gene M. Why isa cDNA clone of gene M not appropriate for your study? (2 marks) (b) Outline the steps you would...

How can you generate a mouse that expresses a gene on demand as an adult mouse....

How can you generate a mouse that expresses a gene on demand as an adult mouse. none of the above using a tissue specific promotor to drive expression of a tetracycline response element and ubiquitous promotor to control expression of the gene of interest with lots of training using a tissue specific promotor to drive expression of a tetracycline reregulatory protein and a tetracycline response element to control expression of the gene of interest that is driven by a ubiquitous...
What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the...

What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the DNA immediately upstream of the transcription start site, but expression of the gene can also be affected by control elements. These can be thousands of base pairs upstream of the promoter, grouped in an enhancer. Because the distance and spacing of these control elements make them difficult to identify, scientists begin by deleting sections of DNA that contain possible control elements and measuring the...
6a) You want to use homologous recombination to generate a mouse that does not express a functional XPC gene (‘Knock-out...

6a) You want to use homologous recombination to generate a mouse that does not express a functional XPC gene (‘Knock-out’ or KO). To do this, you want to delete exon 10 and replace it with a gene that confers resistance to the drug Neomycin (NEO. The usual second selection with tk we discussed in class is not shown here). Using the diagram as a guide: illustrate on the diagram where you expect crossing over to occur and (below the diagram)...

When attempting a targeted gene knockout using mouse embryonic stem cells, there are three possible outcomes:...

When attempting a targeted gene knockout using mouse embryonic stem cells, there are three possible outcomes: targeted knockout, ectopic insertion, and no insertion. What procedures can be used to select for cells that only have the targeted gene knockout? (9 pts) Describe why Jacob and Monod used IPTG as a synthetic inducer during their experiments investigating the genetic control of the lac operon. (6 pts) Describe the function of the CAP-cAMP system in bacteria. Why does it regulate several operons...

You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

Homework Answers