If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...

Question

Question

Answer 1

Answer #1

ANSWER:

If a template DNA strand has the base sequence 3-GTC. CCA 5, what would be the sequence of the corn 033 CAG..GGU-5 6.5-CA

The mRNA sequence that will be transcribed, will be antiparallel in orientation and will have complementary sequence of the template strand.

Hence, the correct option is (b).

Thanks.

Answer 2

Similar Homework Help Questions

A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...

A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the codon chart provided, answer the following questions: -What is the sequence of amino acids that is produced when this gene is translated? -If a mutation causes a substitution (an A instead of a T) 3’ CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND on the protein? -What do we call this type of mutation? Second letter U С...
A strand of DNA has the base sequence GATTCA

3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...
19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template...

19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template strand used by RNA polymerase, what is the corresponding mRNA sequence? A.5'-GCUUCCCAA-3' C.5'-UUGGGAAGC-3 B. 3'-UUGGGAAGC-5 D. 5-TTGGGAAGC-3 E.3-TTGGGAAGC-5

You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate...

2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'

11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC...

A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below

Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand...

Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________