A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC CAC CGC 3'. Assume the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (May not start at AUG). Enter the mRNA and amino acid sequence below
Sequence of the given template DNA strand is...
5' ATA GCG TTC CAC CGC 3'
RNA polymerase synthesizes ribonucleotides in 5'→3' direction. So, the RNA polymerase will bind at the 3' end of template DNA strand and initiate the process of transcription and will continue to elongate the RNA chain from right to left onward. After transcription of this portion of template DNA strand the mRNA will be generated. And the sequence of the transcripted mRNA will be...
5' GCG GUG GAA CGC UAU 3'
Assuming that the first codon for the peptide begins with the first nucleotide of the portion of mRNA and there are no introns (may jot start at AUG), the amnio acid sequence will be as following...
Ala - Val - Glu - Arg - Tyr
**** IF YOU LIKE THE ANSWER PLEASE HIT THE THUMBS-UP. THANK YOU :-)
A portion of the template strand of DNA has the following sequence: 5' ATA GCG TTC...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
Please answer this DNA question with details. Thanks The following is the transcribed strand of DNA: GCG GCG TAC CCC AAA ATA GGG GCG CTC GCG ATT AAA CCG TTC CCC What is the untranscribed strand? What is the mRNA sequence that would be transcribed from the transcribed strand? What is the sequence of tRNA nucleotides that would match up with the mRNA? What is the amino acid sequence that would result from translation of the mRNA?
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
can i get help with this question please Reference Sequence Wild-Type DNA Template Sequence: mRNA Sequence: Amino Acid Sequence: TAC ACC TTG GCG ACG ACT AUG UGG AAC CGC UGC UGA Met-Top-Asn--Ars--Y-STOP NS. Mutated DNA Template Sequence #5: TAC ACC TTG GGA CGA CT Compare the mutated DNA#5 with the wild-type DNA sequence. Do you observe a substitution, deletion, or insertion mutation? The mRNA sequence derived from mutated DNA #5 is AUG UGG AAC CCU GCU GA Use Table 10.3...